ID: 957067722

View in Genome Browser
Species Human (GRCh38)
Location 3:75539411-75539433
Sequence GTGAGAAGTGGGGGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957067722_957067731 21 Left 957067722 3:75539411-75539433 CCAGCCACTCCCCCACTTCTCAC No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data
957067722_957067732 22 Left 957067722 3:75539411-75539433 CCAGCCACTCCCCCACTTCTCAC No data
Right 957067732 3:75539456-75539478 TTCCCATCGTTCCAAGCCTTGGG No data
957067722_957067728 -8 Left 957067722 3:75539411-75539433 CCAGCCACTCCCCCACTTCTCAC No data
Right 957067728 3:75539426-75539448 CTTCTCACCTTAAACACAGATGG No data
957067722_957067733 23 Left 957067722 3:75539411-75539433 CCAGCCACTCCCCCACTTCTCAC No data
Right 957067733 3:75539457-75539479 TCCCATCGTTCCAAGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957067722 Original CRISPR GTGAGAAGTGGGGGAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr