ID: 957067723

View in Genome Browser
Species Human (GRCh38)
Location 3:75539415-75539437
Sequence TAAGGTGAGAAGTGGGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957067723_957067731 17 Left 957067723 3:75539415-75539437 CCACTCCCCCACTTCTCACCTTA No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data
957067723_957067732 18 Left 957067723 3:75539415-75539437 CCACTCCCCCACTTCTCACCTTA No data
Right 957067732 3:75539456-75539478 TTCCCATCGTTCCAAGCCTTGGG No data
957067723_957067733 19 Left 957067723 3:75539415-75539437 CCACTCCCCCACTTCTCACCTTA No data
Right 957067733 3:75539457-75539479 TCCCATCGTTCCAAGCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957067723 Original CRISPR TAAGGTGAGAAGTGGGGGAG TGG (reversed) Intergenic
No off target data available for this crispr