ID: 957067724

View in Genome Browser
Species Human (GRCh38)
Location 3:75539420-75539442
Sequence GTGTTTAAGGTGAGAAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957067724_957067733 14 Left 957067724 3:75539420-75539442 CCCCCACTTCTCACCTTAAACAC No data
Right 957067733 3:75539457-75539479 TCCCATCGTTCCAAGCCTTGGGG No data
957067724_957067732 13 Left 957067724 3:75539420-75539442 CCCCCACTTCTCACCTTAAACAC No data
Right 957067732 3:75539456-75539478 TTCCCATCGTTCCAAGCCTTGGG No data
957067724_957067731 12 Left 957067724 3:75539420-75539442 CCCCCACTTCTCACCTTAAACAC No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957067724 Original CRISPR GTGTTTAAGGTGAGAAGTGG GGG (reversed) Intergenic
No off target data available for this crispr