ID: 957067731

View in Genome Browser
Species Human (GRCh38)
Location 3:75539455-75539477
Sequence CTTCCCATCGTTCCAAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957067723_957067731 17 Left 957067723 3:75539415-75539437 CCACTCCCCCACTTCTCACCTTA No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data
957067722_957067731 21 Left 957067722 3:75539411-75539433 CCAGCCACTCCCCCACTTCTCAC No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data
957067724_957067731 12 Left 957067724 3:75539420-75539442 CCCCCACTTCTCACCTTAAACAC No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data
957067727_957067731 9 Left 957067727 3:75539423-75539445 CCACTTCTCACCTTAAACACAGA No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data
957067729_957067731 -1 Left 957067729 3:75539433-75539455 CCTTAAACACAGATGGCAGCTCC No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data
957067726_957067731 10 Left 957067726 3:75539422-75539444 CCCACTTCTCACCTTAAACACAG No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data
957067725_957067731 11 Left 957067725 3:75539421-75539443 CCCCACTTCTCACCTTAAACACA No data
Right 957067731 3:75539455-75539477 CTTCCCATCGTTCCAAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957067731 Original CRISPR CTTCCCATCGTTCCAAGCCT TGG Intergenic
No off target data available for this crispr