ID: 957070765

View in Genome Browser
Species Human (GRCh38)
Location 3:75566193-75566215
Sequence CATGGTGACCACAGTCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957070756_957070765 22 Left 957070756 3:75566148-75566170 CCAGAGAAACAAATGAGAATCAG No data
Right 957070765 3:75566193-75566215 CATGGTGACCACAGTCTTGAAGG No data
957070761_957070765 -7 Left 957070761 3:75566177-75566199 CCATGGCCCTGGTCCTCATGGTG No data
Right 957070765 3:75566193-75566215 CATGGTGACCACAGTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957070765 Original CRISPR CATGGTGACCACAGTCTTGA AGG Intergenic
No off target data available for this crispr