ID: 957071148

View in Genome Browser
Species Human (GRCh38)
Location 3:75568807-75568829
Sequence TCTGCACTCTGGTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957071148_957071155 5 Left 957071148 3:75568807-75568829 CCCCCAGGACACCAGAGTGCAGA No data
Right 957071155 3:75568835-75568857 GTGAGTAAAAGAAAGAGAGGCGG No data
957071148_957071154 2 Left 957071148 3:75568807-75568829 CCCCCAGGACACCAGAGTGCAGA No data
Right 957071154 3:75568832-75568854 GGTGTGAGTAAAAGAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957071148 Original CRISPR TCTGCACTCTGGTGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr