ID: 957072329

View in Genome Browser
Species Human (GRCh38)
Location 3:75576934-75576956
Sequence GCTGTGGGTCAGACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957072320_957072329 17 Left 957072320 3:75576894-75576916 CCAAATACCTAGGAGAGACTTTT No data
Right 957072329 3:75576934-75576956 GCTGTGGGTCAGACACACCCTGG No data
957072326_957072329 -10 Left 957072326 3:75576921-75576943 CCCTCCAGGAGGAGCTGTGGGTC No data
Right 957072329 3:75576934-75576956 GCTGTGGGTCAGACACACCCTGG No data
957072321_957072329 10 Left 957072321 3:75576901-75576923 CCTAGGAGAGACTTTTCTCTCCC No data
Right 957072329 3:75576934-75576956 GCTGTGGGTCAGACACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957072329 Original CRISPR GCTGTGGGTCAGACACACCC TGG Intergenic
No off target data available for this crispr