ID: 957072827

View in Genome Browser
Species Human (GRCh38)
Location 3:75579745-75579767
Sequence CTCCCGGCCAGGGACGTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957072813_957072827 15 Left 957072813 3:75579707-75579729 CCCCCTCCCCTTTTGGCTAGCCG No data
Right 957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG No data
957072818_957072827 8 Left 957072818 3:75579714-75579736 CCCTTTTGGCTAGCCGCAGAGTC No data
Right 957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG No data
957072819_957072827 7 Left 957072819 3:75579715-75579737 CCTTTTGGCTAGCCGCAGAGTCC No data
Right 957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG No data
957072811_957072827 30 Left 957072811 3:75579692-75579714 CCAGGACGCGGGGCTCCCCCTCC No data
Right 957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG No data
957072816_957072827 12 Left 957072816 3:75579710-75579732 CCTCCCCTTTTGGCTAGCCGCAG No data
Right 957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG No data
957072815_957072827 13 Left 957072815 3:75579709-75579731 CCCTCCCCTTTTGGCTAGCCGCA No data
Right 957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG No data
957072821_957072827 -5 Left 957072821 3:75579727-75579749 CCGCAGAGTCCAGCTGGTCTCCC No data
Right 957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG No data
957072814_957072827 14 Left 957072814 3:75579708-75579730 CCCCTCCCCTTTTGGCTAGCCGC No data
Right 957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG No data
957072817_957072827 9 Left 957072817 3:75579713-75579735 CCCCTTTTGGCTAGCCGCAGAGT No data
Right 957072827 3:75579745-75579767 CTCCCGGCCAGGGACGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957072827 Original CRISPR CTCCCGGCCAGGGACGTCGT GGG Intergenic