ID: 957072878

View in Genome Browser
Species Human (GRCh38)
Location 3:75579948-75579970
Sequence ACGCGGGCGCAGGGGTCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957072878_957072888 9 Left 957072878 3:75579948-75579970 CCCCCGGACCCCTGCGCCCGCGT No data
Right 957072888 3:75579980-75580002 CTCTGCCGTCGCCACCTGTCTGG No data
957072878_957072889 10 Left 957072878 3:75579948-75579970 CCCCCGGACCCCTGCGCCCGCGT No data
Right 957072889 3:75579981-75580003 TCTGCCGTCGCCACCTGTCTGGG No data
957072878_957072891 16 Left 957072878 3:75579948-75579970 CCCCCGGACCCCTGCGCCCGCGT No data
Right 957072891 3:75579987-75580009 GTCGCCACCTGTCTGGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957072878 Original CRISPR ACGCGGGCGCAGGGGTCCGG GGG (reversed) Intergenic