ID: 957073065

View in Genome Browser
Species Human (GRCh38)
Location 3:75580614-75580636
Sequence CTGTGTCTTGCATGGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957073060_957073065 -4 Left 957073060 3:75580595-75580617 CCTTGTCTTTGCTCTTACCCTGT No data
Right 957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG No data
957073058_957073065 5 Left 957073058 3:75580586-75580608 CCACAGCCACCTTGTCTTTGCTC No data
Right 957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG No data
957073059_957073065 -1 Left 957073059 3:75580592-75580614 CCACCTTGTCTTTGCTCTTACCC No data
Right 957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG No data
957073056_957073065 25 Left 957073056 3:75580566-75580588 CCCGAGAGGGTGGACATCGGCCA No data
Right 957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG No data
957073057_957073065 24 Left 957073057 3:75580567-75580589 CCGAGAGGGTGGACATCGGCCAC No data
Right 957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG No data
957073055_957073065 26 Left 957073055 3:75580565-75580587 CCCCGAGAGGGTGGACATCGGCC No data
Right 957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957073065 Original CRISPR CTGTGTCTTGCATGGTTTGG AGG Intergenic
No off target data available for this crispr