ID: 957074055

View in Genome Browser
Species Human (GRCh38)
Location 3:75587830-75587852
Sequence TCCAGCTGGCAGGGAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957074055_957074067 15 Left 957074055 3:75587830-75587852 CCGGCGCTTCCCTGCCAGCTGGA No data
Right 957074067 3:75587868-75587890 GGGCTTGGCTGGCCCACACTAGG No data
957074055_957074068 20 Left 957074055 3:75587830-75587852 CCGGCGCTTCCCTGCCAGCTGGA No data
Right 957074068 3:75587873-75587895 TGGCTGGCCCACACTAGGAGCGG No data
957074055_957074064 0 Left 957074055 3:75587830-75587852 CCGGCGCTTCCCTGCCAGCTGGA No data
Right 957074064 3:75587853-75587875 GTTCCAGGTGGGCATGGGCTTGG 0: 28
1: 183
2: 831
3: 582
4: 567
957074055_957074069 24 Left 957074055 3:75587830-75587852 CCGGCGCTTCCCTGCCAGCTGGA No data
Right 957074069 3:75587877-75587899 TGGCCCACACTAGGAGCGGCTGG No data
957074055_957074066 4 Left 957074055 3:75587830-75587852 CCGGCGCTTCCCTGCCAGCTGGA No data
Right 957074066 3:75587857-75587879 CAGGTGGGCATGGGCTTGGCTGG No data
957074055_957074063 -5 Left 957074055 3:75587830-75587852 CCGGCGCTTCCCTGCCAGCTGGA No data
Right 957074063 3:75587848-75587870 CTGGAGTTCCAGGTGGGCATGGG 0: 12
1: 110
2: 547
3: 420
4: 849
957074055_957074062 -6 Left 957074055 3:75587830-75587852 CCGGCGCTTCCCTGCCAGCTGGA No data
Right 957074062 3:75587847-75587869 GCTGGAGTTCCAGGTGGGCATGG 0: 12
1: 116
2: 570
3: 490
4: 929
957074055_957074072 28 Left 957074055 3:75587830-75587852 CCGGCGCTTCCCTGCCAGCTGGA No data
Right 957074072 3:75587881-75587903 CCACACTAGGAGCGGCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957074055 Original CRISPR TCCAGCTGGCAGGGAAGCGC CGG (reversed) Intergenic
No off target data available for this crispr