ID: 957076735

View in Genome Browser
Species Human (GRCh38)
Location 3:75608645-75608667
Sequence ATGCACACCCACTGCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957076735_957076740 9 Left 957076735 3:75608645-75608667 CCAAGATAGCAGTGGGTGTGCAT No data
Right 957076740 3:75608677-75608699 GATATTCCTCCTAATATTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957076735 Original CRISPR ATGCACACCCACTGCTATCT TGG (reversed) Intergenic
No off target data available for this crispr