ID: 957076740

View in Genome Browser
Species Human (GRCh38)
Location 3:75608677-75608699
Sequence GATATTCCTCCTAATATTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957076735_957076740 9 Left 957076735 3:75608645-75608667 CCAAGATAGCAGTGGGTGTGCAT No data
Right 957076740 3:75608677-75608699 GATATTCCTCCTAATATTCCCGG No data
957076734_957076740 10 Left 957076734 3:75608644-75608666 CCCAAGATAGCAGTGGGTGTGCA No data
Right 957076740 3:75608677-75608699 GATATTCCTCCTAATATTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957076740 Original CRISPR GATATTCCTCCTAATATTCC CGG Intergenic
No off target data available for this crispr