ID: 957078579

View in Genome Browser
Species Human (GRCh38)
Location 3:75619447-75619469
Sequence GAGGAGGGAGGCTGAGTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957078565_957078579 11 Left 957078565 3:75619413-75619435 CCCCCGACCTAAGACGTGGTAAA No data
Right 957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG No data
957078568_957078579 8 Left 957078568 3:75619416-75619438 CCGACCTAAGACGTGGTAAACTG No data
Right 957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG No data
957078564_957078579 12 Left 957078564 3:75619412-75619434 CCCCCCGACCTAAGACGTGGTAA No data
Right 957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG No data
957078567_957078579 9 Left 957078567 3:75619415-75619437 CCCGACCTAAGACGTGGTAAACT No data
Right 957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG No data
957078566_957078579 10 Left 957078566 3:75619414-75619436 CCCCGACCTAAGACGTGGTAAAC No data
Right 957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG No data
957078570_957078579 4 Left 957078570 3:75619420-75619442 CCTAAGACGTGGTAAACTGAGGC No data
Right 957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957078579 Original CRISPR GAGGAGGGAGGCTGAGTCCG GGG Intergenic
No off target data available for this crispr