ID: 957080746

View in Genome Browser
Species Human (GRCh38)
Location 3:75633837-75633859
Sequence CAGAGAGTAGGGAAGGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957080746_957080753 2 Left 957080746 3:75633837-75633859 CCGACTTCCTTCCCTACTCTCTG No data
Right 957080753 3:75633862-75633884 GCCCAGATGGGAAAACTTGGAGG No data
957080746_957080752 -1 Left 957080746 3:75633837-75633859 CCGACTTCCTTCCCTACTCTCTG No data
Right 957080752 3:75633859-75633881 GCAGCCCAGATGGGAAAACTTGG No data
957080746_957080751 -10 Left 957080746 3:75633837-75633859 CCGACTTCCTTCCCTACTCTCTG No data
Right 957080751 3:75633850-75633872 CTACTCTCTGCAGCCCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957080746 Original CRISPR CAGAGAGTAGGGAAGGAAGT CGG (reversed) Intergenic
No off target data available for this crispr