ID: 957081187

View in Genome Browser
Species Human (GRCh38)
Location 3:75637113-75637135
Sequence TCTTGGGTGGACAGGCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957081187_957081194 8 Left 957081187 3:75637113-75637135 CCTGTTTGCCTGTCCACCCAAGA No data
Right 957081194 3:75637144-75637166 AGCAAAAACAACAAAGCTGGAGG 0: 108
1: 4618
2: 15828
3: 7273
4: 5106
957081187_957081193 5 Left 957081187 3:75637113-75637135 CCTGTTTGCCTGTCCACCCAAGA No data
Right 957081193 3:75637141-75637163 CTAAGCAAAAACAACAAAGCTGG 0: 89
1: 4546
2: 15574
3: 6936
4: 3933

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957081187 Original CRISPR TCTTGGGTGGACAGGCAAAC AGG (reversed) Intergenic
No off target data available for this crispr