ID: 957084852

View in Genome Browser
Species Human (GRCh38)
Location 3:75669536-75669558
Sequence GGCTCCCGAAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 37, 2: 10, 3: 21, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957084852_957084861 16 Left 957084852 3:75669536-75669558 CCCACAGGGGGCTTTCGGGAGCC 0: 1
1: 37
2: 10
3: 21
4: 91
Right 957084861 3:75669575-75669597 CCCCGTGCTCCAGCCCAGCCAGG 0: 9
1: 10
2: 35
3: 72
4: 786
957084852_957084865 25 Left 957084852 3:75669536-75669558 CCCACAGGGGGCTTTCGGGAGCC 0: 1
1: 37
2: 10
3: 21
4: 91
Right 957084865 3:75669584-75669606 CCAGCCCAGCCAGGCCGCGCCGG 0: 5
1: 35
2: 12
3: 42
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957084852 Original CRISPR GGCTCCCGAAAGCCCCCTGT GGG (reversed) Intergenic
900625470 1:3606573-3606595 GGCTCCCGACAGCCCTCAGGAGG + Intronic
905404123 1:37721830-37721852 AGCTCCCCAAACCGCCCTGTGGG + Exonic
905663039 1:39743059-39743081 GCCACCCCAAAGCCACCTGTGGG - Intronic
910192016 1:84604459-84604481 GGATCACGAAATCCCCCTGTCGG - Intergenic
910876905 1:91886264-91886286 GGCGGCCGAGAGCCCCCGGTGGG - Exonic
913536673 1:119779551-119779573 GGCCCCCGAAGGCCTCCTGGGGG - Intergenic
1069044206 10:63724812-63724834 GCCTCCCCAAAGCCCCCCTTGGG + Intergenic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077184262 11:1229318-1229340 GGGACCTGAAAGCCCCCTGAGGG - Intronic
1078259738 11:9694341-9694363 TGGGCCCAAAAGCCCCCTGTTGG + Intronic
1078406053 11:11070935-11070957 GGCTCCCCAAAGAGCCCTGTGGG + Intergenic
1083615165 11:64022465-64022487 CGCTCCCCTAAGCCCCCTGTGGG - Intronic
1083945905 11:65922454-65922476 GGCTCCAGGAGGCCCCATGTGGG - Intergenic
1084431640 11:69114583-69114605 GGCCCCAGAAGGACCCCTGTAGG - Intergenic
1087797235 11:102467306-102467328 GGCACCAGCAAGCCACCTGTTGG - Exonic
1089284008 11:117394216-117394238 GGCTCCCTAAAGCCAGCTCTTGG - Intronic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1103944944 12:124520828-124520850 GGCTCCAGGAAGCGGCCTGTCGG - Intronic
1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG + Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1106503974 13:30355526-30355548 AGCTCCCGGAGGCCCCCTGCTGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114269599 14:21092636-21092658 GGCTCCCGAGCGTCCCCTGGCGG - Exonic
1114690129 14:24573795-24573817 GGCCTCCGGAATCCCCCTGTAGG + Exonic
1118728530 14:68649984-68650006 GGCTCCTGAGAGCCACCTCTTGG + Intronic
1122022849 14:98853777-98853799 CGCTCCCAAAAGCTCCATGTGGG - Intergenic
1122789201 14:104177253-104177275 GGGGCCCCCAAGCCCCCTGTTGG + Exonic
1123041176 14:105490818-105490840 GACTCCGGAAGGCGCCCTGTGGG - Intronic
1123180287 14:106463172-106463194 GGGTCCCGAGCGCCCCCAGTTGG + Intergenic
1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG + Intergenic
1123218009 14:106830715-106830737 GTGTCCCGAGCGCCCCCTGTTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202849684 14_GL000225v1_random:8991-9013 GGCTCACGAAATCCCCCAGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202857160 14_GL000225v1_random:58698-58720 GGCACATGAAAGACCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1202946612 14_KI270726v1_random:33481-33503 GGGTCCCGAGCGCCCCCAGTTGG - Intergenic
1132253460 15:100352289-100352311 GGCACCCAAAAGCAACCTGTAGG + Intergenic
1134502070 16:14777007-14777029 GGTTCCCCAAAGCCCTCTGCAGG - Intronic
1134578491 16:15351886-15351908 GGTTCCCCAAAGCCCTCTGCAGG + Intergenic
1134724097 16:16405658-16405680 GGTTCCCCAAAGCCCTCTGCAGG - Intergenic
1134943332 16:18306211-18306233 GGTTCCCCAAAGCCCTCTGCAGG + Intergenic
1136910679 16:34141882-34141904 GGCTCACGAAAGCCCCATGTGGG + Intergenic
1136910767 16:34142520-34142542 GGCTCACGAAAGCCCCATGTGGG - Intergenic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1143762605 17:9116046-9116068 AGCCCCAGAAAGCCGCCTGTGGG + Intronic
1145797683 17:27665508-27665530 GACTCCCAAATGCCCTCTGTAGG + Intergenic
1148238143 17:45983066-45983088 GGCTCCTGAGGGCCTCCTGTTGG - Intronic
1150492968 17:65587033-65587055 CACTCCAGACAGCCCCCTGTGGG - Intronic
1156710906 18:39944252-39944274 GGCTCCCCAAGTCCCCCAGTGGG - Intergenic
1161647912 19:5465701-5465723 GGCTCCCCAAGGTCCCCAGTGGG - Intergenic
1167034454 19:46985972-46985994 GGCTTCCGAGAGCCACGTGTTGG - Intronic
1168249886 19:55135874-55135896 GGCTCCTGGAAGCCCTCTGGGGG - Intronic
1168535723 19:57167768-57167790 GGCTCCCCCAACCCCCTTGTGGG + Intergenic
925139823 2:1542455-1542477 GGCTGCCGAGAGCCCTCTGAGGG + Exonic
931152020 2:59585126-59585148 GGATCCAGAATGCCCCCTGGTGG + Intergenic
935589734 2:104835440-104835462 AGCTCCTGAAAGCCCTCTGAAGG - Intergenic
945162532 2:206907824-206907846 GGATCCAGCAATCCCCCTGTGGG + Intergenic
947656978 2:231835893-231835915 GGCTCCCGAAACCCTTCTCTAGG + Intergenic
947658427 2:231848175-231848197 GGCTCCCGAAACCCTTCTCTAGG + Intergenic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1169869994 20:10239887-10239909 GGTTCCAGAAAGGCCCCTGTAGG - Intronic
1171091543 20:22290163-22290185 GGATGCTGAAAGCCCCCTGAAGG + Intergenic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1172122184 20:32604938-32604960 GGCTCCTGAAGGTCCCCTGAAGG + Intronic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1173793345 20:45841941-45841963 AGCCCCCGAGAGCCACCTGTGGG + Exonic
1179457635 21:41509857-41509879 CTCTCCCGGAAGCCTCCTGTGGG + Intronic
1180049058 21:45323111-45323133 GCCTCCCGAGAGCCCCGTGCAGG - Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1181030402 22:20146737-20146759 GGTTCCTGAGAGTCCCCTGTGGG - Intronic
1181365191 22:22371099-22371121 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1181368375 22:22397464-22397486 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1182330721 22:29549918-29549940 GTCTCCCCAAAGCCCTCTTTTGG + Intronic
952885931 3:38010967-38010989 GGGTCCTCAAAGCCCCCTGAAGG + Intronic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
962739727 3:138354410-138354432 GGCTCCCAAAAGCCCATTGCAGG - Intronic
963071978 3:141311929-141311951 GGCTCACGAACGACCCCTGGAGG - Intergenic
966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG + Intergenic
972922817 4:43965303-43965325 AGCTCCCTTAAGCACCCTGTGGG + Intergenic
974546659 4:63318246-63318268 GGATCCAGAAAGCCCACTTTTGG + Intergenic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
990242021 5:53825355-53825377 GGCTCCAGAAAGGCCCATGTGGG + Intergenic
997251606 5:132392910-132392932 GGCTCCCTAAACCACTCTGTAGG - Intronic
999782076 5:154857918-154857940 GGCTCCCCAAAGCCGAATGTGGG - Intronic
1002712407 5:181203514-181203536 GGCACCCGCAGGCCCCCCGTGGG - Intronic
1006578674 6:35064099-35064121 GGCTCTCGAAAGCCACGTGTGGG + Intronic
1016642133 6:146361193-146361215 GGCTCCAGAACTGCCCCTGTTGG - Intronic
1017716802 6:157218653-157218675 GGCTCCCCAAGGCCCCCGGCTGG + Intergenic
1020264892 7:6553707-6553729 GGCTCCAAAAAGCCCTCTGTAGG - Intergenic
1024547966 7:50538256-50538278 GGGTCCAGAAAGCCCACTGGTGG + Intronic
1029513643 7:101012605-101012627 TGCTCCCAACAGCCCCCTCTCGG + Intronic
1031390129 7:121203538-121203560 GGCTCCCTAACTGCCCCTGTGGG + Intronic
1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG + Intergenic
1038326923 8:26578740-26578762 GGCTCCAGAAAGCCCTTTTTGGG - Intronic
1046021129 8:108666456-108666478 GGGTCCAGGAAGCCCCCTGGTGG - Intronic
1049588940 8:143446811-143446833 GGCCCCAGAGGGCCCCCTGTGGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG + Intronic
1056954928 9:91074151-91074173 GGCTCCGGAAGGCCACCTCTGGG - Intergenic
1059914908 9:119088145-119088167 GGGTCTCCAAAGCACCCTGTGGG - Intergenic
1061413458 9:130433098-130433120 GGATCCCGAAAGTCCGCTGGAGG + Intronic
1062236920 9:135514809-135514831 GGCTCCAGGAAGCCCTCTCTGGG - Intergenic
1203740054 Un_GL000216v2:171068-171090 GTCTCACAAAAGCCCCCTGTGGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG + Intergenic
1187830985 X:23380741-23380763 GTCTCCCAAAGGTCCCCTGTGGG - Intronic
1189599342 X:42605880-42605902 TGGTCCCCTAAGCCCCCTGTGGG - Intergenic
1190381735 X:49845718-49845740 GGCTCCCGAGAGCCAATTGTGGG - Intergenic
1190834046 X:54084070-54084092 GCCTCCTGAAAGCCCACAGTAGG - Intronic
1192184070 X:68934665-68934687 GGGTCCTGAAAGACCTCTGTGGG - Intergenic
1200150186 X:153947464-153947486 GGCTCACGGGAGCCCCCTGGAGG - Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201179700 Y:11332936-11332958 GGCTCACAAAAGCTCCCTGTGGG - Intergenic
1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG + Intergenic