ID: 957085545

View in Genome Browser
Species Human (GRCh38)
Location 3:75673191-75673213
Sequence TAGGGCTTCCACTGTAAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957085538_957085545 20 Left 957085538 3:75673148-75673170 CCTTTAGTACTTTAAATATTTAT No data
Right 957085545 3:75673191-75673213 TAGGGCTTCCACTGTAAAGTCGG 0: 1
1: 0
2: 1
3: 15
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957085545 Original CRISPR TAGGGCTTCCACTGTAAAGT CGG Intergenic
902592348 1:17484123-17484145 CAGGGCTTCCATTCTAATGTGGG + Intergenic
904963807 1:34356112-34356134 TAGGGGTTCCACTGAAAAGGAGG + Intergenic
906826861 1:48991323-48991345 TGAGGTTTCCACTGAAAAGTCGG + Intronic
908113613 1:60920573-60920595 TAGGGCTTCCACAGTGAGGCAGG - Intronic
909384984 1:75044158-75044180 TAAGGTTTCCACTGAAAAGTCGG - Intergenic
910768270 1:90804534-90804556 TAGGACTTCCAGTGCAATGTTGG + Intergenic
912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG + Intergenic
916459400 1:165007695-165007717 TTGGTCTTGCTCTGTAAAGTGGG + Intergenic
924480991 1:244433976-244433998 TAGGTCTTCCACAGTTAAATGGG - Intronic
1063189510 10:3680091-3680113 TAGGGCTGACACTGTTAGGTGGG - Intergenic
1065320964 10:24509676-24509698 TAAGGCTTCCACTCAACAGTAGG - Intronic
1067549023 10:47220286-47220308 CAGGGCTTCCACTATGAATTTGG - Intergenic
1068192372 10:53668025-53668047 TAGAGCTTCCCCTGTAAAGAGGG + Intergenic
1070412182 10:76151896-76151918 TAGGACCTCCAGTGTAATGTAGG + Intronic
1070468667 10:76753790-76753812 TAGGATTTCCATTGTAATGTTGG - Intergenic
1071662174 10:87515603-87515625 TAGGACTTTCACTGTGAAATAGG + Intronic
1077024669 11:433810-433832 AAGGGCTTCCACATTAAGGTGGG - Exonic
1077403389 11:2369821-2369843 TAGGGCTCCCAGTGTAGAGGGGG - Intergenic
1081642830 11:44768614-44768636 TAGGACTTCCAGTATAATGTGGG + Intronic
1084370753 11:68741183-68741205 TATGGCTTCCACTCTAAAGAGGG - Intronic
1086890366 11:92251233-92251255 AAGGGCTTCATCTGTAAAGATGG - Intergenic
1088003054 11:104905885-104905907 TATTCCTTCCTCTGTAAAGTGGG - Intergenic
1088006523 11:104947522-104947544 TATTTCTTCCTCTGTAAAGTGGG - Intronic
1088614788 11:111614410-111614432 TAAGGCTTCCAGTGAACAGTAGG - Intronic
1091306903 11:134542110-134542132 TGCGTCTTCCACTGTGAAGTTGG + Intergenic
1093964919 12:25313887-25313909 TAGGACTTCCAGTGTTATGTTGG - Intergenic
1099424154 12:82502084-82502106 TTTGACTTCCACTGTAGAGTGGG - Intergenic
1099749753 12:86757735-86757757 TAGGGTTTCTACTGTATTGTTGG - Intronic
1101035980 12:100706945-100706967 TAGGACTTGCACTGGAAAGGGGG + Intergenic
1103981047 12:124737129-124737151 TGGGGCTGCCCCTGTAAAATCGG - Intergenic
1106516311 13:30457397-30457419 TTGGGCATCCACTGAAAAGAAGG - Exonic
1107634617 13:42379666-42379688 TAGGGCTGCCATAATAAAGTTGG + Intergenic
1108811515 13:54230482-54230504 TACTGCTTGCACTGTAAAGGTGG + Intergenic
1109100528 13:58179201-58179223 TAAGGTTTCCACTGAGAAGTCGG + Intergenic
1111451119 13:88418319-88418341 TAGTGCTACCACTATAAAGTGGG - Intergenic
1111663330 13:91237810-91237832 TGAGGCTTCCACTCTAATGTGGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1114818292 14:25985869-25985891 AAGGGCTGGCACTGTAAAGCAGG - Intergenic
1115454584 14:33587394-33587416 TAGGGCTTGCACTAGACAGTTGG - Intronic
1120461067 14:84795948-84795970 TGGAGCTTCCATTGTAATGTTGG + Intergenic
1120938197 14:89919343-89919365 CAGGGCCTGCACTGTTAAGTGGG - Intronic
1125367020 15:38928470-38928492 TAGGACTTCCAGTGTTATGTTGG + Intergenic
1130132347 15:81154531-81154553 TAAGGCTTCCACTGCAGAGAGGG + Intergenic
1130957105 15:88635043-88635065 TAAGGCTTCCAATCAAAAGTAGG - Intergenic
1135147769 16:19978025-19978047 TTGGGCTTCCAGTGGACAGTAGG + Intergenic
1135516463 16:23139726-23139748 TAAGGCTTCCTCTCTTAAGTGGG + Intronic
1138230454 16:55332223-55332245 TAGGGCTTCCAGTTGAGAGTAGG + Intergenic
1138613835 16:58148644-58148666 TAGTGCTTGCACTTTTAAGTGGG + Intergenic
1139270439 16:65677531-65677553 TAGGTCATCCAGTGTCAAGTTGG - Intergenic
1144616712 17:16782678-16782700 TAGGGTTTCCACTGAGAGGTCGG + Intronic
1144895980 17:18532983-18533005 TAGGGTTTCCACTGAGAGGTCGG - Intergenic
1145095382 17:20020952-20020974 TAAGGCTTCCACTCAACAGTAGG - Intronic
1145136233 17:20411237-20411259 TAGGGTTTCCACTGAGAGGTCGG + Intergenic
1145242229 17:21246778-21246800 CAGGGCTGCCACTGTAAAGAGGG + Intronic
1146429334 17:32775679-32775701 TAGCACTTACACTGTCAAGTTGG - Intronic
1149435670 17:56631327-56631349 TGGGGCCTCCTCTGTAAAATGGG + Intergenic
1151191956 17:72405186-72405208 TCGGCTTTCCACTATAAAGTGGG - Intergenic
1152960334 18:75929-75951 TGGGGCTTCCACTGTGAGGACGG - Intergenic
1157028951 18:43881118-43881140 TTGATCTTCCACTTTAAAGTTGG + Intergenic
1161704744 19:5814347-5814369 TAGGGCTTTCAGGGTAGAGTAGG + Intergenic
926500755 2:13649720-13649742 TAGGGCTTCAACTGGAAGCTTGG + Intergenic
928366370 2:30706346-30706368 TAGGGGTCTCACTTTAAAGTTGG - Intergenic
929615889 2:43306977-43306999 TGGTTCTTCAACTGTAAAGTGGG - Intronic
929683103 2:44011251-44011273 CAGGACTTTCACTGTAAAGAGGG - Intergenic
931162442 2:59707175-59707197 TAAGGCTTCCAGTGAACAGTAGG + Intergenic
932663657 2:73679203-73679225 TAGGGCTTCCCCTGTTAAAATGG + Intergenic
936484048 2:112911435-112911457 GAGGGCTTCCACTAACAAGTAGG + Intergenic
937062835 2:118992959-118992981 TTGGGTTGGCACTGTAAAGTGGG + Intronic
939084655 2:137704975-137704997 TAAGGCTTCCAGTCTACAGTAGG + Intergenic
940119486 2:150247862-150247884 TAGGGCCTCCACTAAAATGTTGG - Intergenic
940714900 2:157210596-157210618 TAAGGTTTCCACTGGACAGTTGG + Intergenic
940881958 2:158955412-158955434 TTAGGCTTCTTCTGTAAAGTTGG - Intergenic
941926049 2:170896070-170896092 TAGGGCTTTGACTGTGAAGTGGG - Intergenic
944233273 2:197417200-197417222 TAATGCTTCCACTGAAAAATAGG + Intronic
944326511 2:198411849-198411871 TAGGACTTCCAATGTAAGTTTGG + Intronic
945630817 2:212273976-212273998 TAAGGCTTCCAGTGAACAGTAGG - Intronic
1168910346 20:1442063-1442085 AAGGTTTTGCACTGTAAAGTGGG + Intergenic
1170127636 20:12983576-12983598 TAGTGCTTTCACTGAAAATTTGG + Intergenic
1170698705 20:18684023-18684045 TAGGCCTTTCCCTGGAAAGTGGG + Intronic
1171133816 20:22678634-22678656 AGGGGCTACCACTGTAAAATGGG + Intergenic
1172329907 20:34068305-34068327 TAGGGCTGCCACTCTAAGCTAGG + Intronic
1172436960 20:34935813-34935835 CAGGGCTTCCACTGAAAACAGGG + Intronic
1177578168 21:22984910-22984932 TAAGGTTTCCACTAAAAAGTTGG - Intergenic
1178020775 21:28406171-28406193 TAAGGCTTCCACTCAACAGTAGG + Intergenic
1184070959 22:42146069-42146091 TAAGGTTTCCACTGGAAAGGTGG - Intergenic
949587418 3:5455363-5455385 TAGGGCTTCCAGTGCCAAGACGG - Intergenic
949845802 3:8369476-8369498 CAATGCTTCAACTGTAAAGTTGG + Intergenic
950116705 3:10455450-10455472 CTGGGCTTCCTCTGTAAAGTGGG + Intronic
950438882 3:12995784-12995806 CAGGGGATCCACTGTACAGTTGG - Intronic
953327018 3:42020802-42020824 CAGGGCTCCCACAGTAAACTTGG + Intronic
953375064 3:42421568-42421590 TGGGTCTTCCTCTGTAAAATGGG - Intergenic
955152878 3:56385941-56385963 TAGGGCATCCACTGTAAACTTGG + Intronic
957085545 3:75673191-75673213 TAGGGCTTCCACTGTAAAGTCGG + Intergenic
960490849 3:118314875-118314897 TAAGGTTTCCACTGAAAAGTCGG - Intergenic
963850354 3:150204790-150204812 TAGGTCTTTCAATGTGAAGTGGG - Intergenic
964798422 3:160525728-160525750 TAGGGCTTCCCCTGTGACATAGG - Intronic
964992734 3:162834278-162834300 TAAGGATTCCACTGAAAAGTTGG + Intergenic
968982402 4:3857344-3857366 CAGGGCTACCACTGTATACTAGG + Intergenic
973843629 4:54888793-54888815 TTTGTCTTCCACTATAAAGTGGG + Intergenic
973865866 4:55112460-55112482 TAGGGCTTCCAGTCAACAGTAGG + Intronic
975539140 4:75486558-75486580 TAGGGTTTTCACTGGAAATTAGG + Intronic
976332838 4:83851821-83851843 TAGGGCTCTAATTGTAAAGTGGG + Intergenic
984389165 4:179106293-179106315 TAGTTTTTGCACTGTAAAGTTGG + Intergenic
985444048 4:190010344-190010366 TAGGGTTTTCACTGAAAATTGGG + Intergenic
987428602 5:17803333-17803355 TAGGGCTTCCACTCAACAATAGG - Intergenic
988340302 5:29961899-29961921 TAAGGGTTCCACTGAAAAGGTGG - Intergenic
989514909 5:42330466-42330488 TAGGCCTTCCAATGCAATGTTGG - Intergenic
989716929 5:44475220-44475242 TAGGGTTTCCACTGGAAATTAGG - Intergenic
990923319 5:60992861-60992883 TAAGGTTTTCACTGAAAAGTTGG + Intronic
992073273 5:73168243-73168265 AAGGGCATCCACTGCAAAGGAGG - Intergenic
993494166 5:88588332-88588354 TAGGGTTTCCACTGAGAAGTCGG - Intergenic
993517117 5:88851316-88851338 TAGGGCTTCCAGTCAACAGTAGG + Intronic
996221927 5:120943624-120943646 AAGAGCTTCAACTGTAAAATGGG + Intergenic
999808612 5:155107242-155107264 CAGGGCCTCCACTGTCACGTCGG + Intergenic
1009056799 6:58346128-58346150 TAAGGCTTCCAATCTACAGTAGG + Intergenic
1009234442 6:61105444-61105466 TAAGGCTTCCAATCTACAGTAGG - Intergenic
1010313895 6:74422168-74422190 TAAGGTTTCCACTAAAAAGTTGG - Intergenic
1010639331 6:78304013-78304035 TAGGCCTTCCAATATATAGTTGG + Intergenic
1011046210 6:83086190-83086212 TAAGGCTTCCAGTCTATAGTAGG - Intronic
1011357038 6:86481769-86481791 TAGGGTTTTCACTATAAATTAGG + Intergenic
1011772014 6:90683734-90683756 TATGGCTCCCACTTAAAAGTAGG - Intergenic
1019918903 7:4150510-4150532 TTGGCCTTCCTCTGTAGAGTGGG - Intronic
1021761484 7:23906344-23906366 GAGGGCTGCCACTGACAAGTAGG + Intergenic
1022270670 7:28804561-28804583 TAGAGCTTGCACTGTTAAGAAGG - Intronic
1024127194 7:46311632-46311654 TAGGGCTTCCAGTAAACAGTAGG - Intergenic
1026892708 7:73991920-73991942 CAGGGCTTCCTCTGTAAGCTAGG + Intergenic
1027427851 7:78080244-78080266 TAAGGGTTCCACTGTAATGAAGG + Intronic
1028891802 7:95996056-95996078 TACGTCTTCCACTGTCAGGTAGG + Exonic
1030946665 7:115731381-115731403 TAGGCCTTCAATTGTGAAGTGGG + Intergenic
1031113646 7:117642826-117642848 CAAGGCTCCCACTGTAAATTTGG - Intronic
1031758797 7:125683247-125683269 TAAGGTTTCTACTGAAAAGTTGG - Intergenic
1032413026 7:131713488-131713510 TAGGGCCTCCAGTATAATGTTGG + Intergenic
1034899185 7:154897000-154897022 TAGGGCTTCAACAGTGAATTTGG + Intergenic
1034934521 7:155190224-155190246 TAGAGCTTCAACTATAAATTTGG - Intergenic
1036164742 8:6422017-6422039 TAGGGCTTGAACTGTGAACTGGG - Intronic
1036688740 8:10928129-10928151 TGGGCCCTCCACTATAAAGTGGG - Intronic
1039120923 8:34145443-34145465 TAGGGCTTCCACAATACAGAAGG + Intergenic
1048854080 8:138671963-138671985 TAAGGCTTCCAGTCTACAGTAGG + Intronic
1050929675 9:11307660-11307682 TAGGGCTTCCACCTGAAACTTGG - Intergenic
1050972940 9:11899977-11899999 TAAGGCTTCCACTCTACAGTAGG - Intergenic
1060234102 9:121850293-121850315 TAGGGTCTCCACTTTAAAGATGG - Intronic
1060912780 9:127363971-127363993 TAGGTCTTCGTCTGTAAAGCAGG - Intronic
1062737763 9:138147775-138147797 TGGGGCTTCCACTGTGAGGACGG + Intergenic
1185853994 X:3516761-3516783 GAAGGCTTCCACTCAAAAGTAGG + Intergenic
1186368758 X:8925151-8925173 TAAGGCTTCCACTCAACAGTAGG - Intergenic
1188856778 X:35206578-35206600 TAAGGCTTCCAGTCAAAAGTAGG + Intergenic
1189602208 X:42639412-42639434 TAAGGCTTCCAGTGAACAGTGGG + Intergenic
1189884048 X:45521977-45521999 TACTGTTTCAACTGTAAAGTGGG - Intergenic
1192739584 X:73880019-73880041 TAGGAGTTCAACTGAAAAGTTGG - Intergenic
1193194659 X:78618006-78618028 TAGGATTTTCACTGAAAAGTTGG + Intergenic
1193260985 X:79405812-79405834 TAAGGTTTCCACTGAAAAGTCGG - Intergenic
1194478130 X:94385722-94385744 TAGGACTTCCGGTGTAACGTTGG - Intergenic
1195719758 X:107855462-107855484 TAGGGCTTCAAGTGTAAACAGGG + Intronic
1196242857 X:113364323-113364345 TAAGATTTCCACTGAAAAGTCGG + Intergenic
1196576406 X:117324087-117324109 TAAGGTTTCCACTGAAAAGTCGG + Intergenic
1196578936 X:117357257-117357279 TAAGATTTCCACTGAAAAGTTGG + Intergenic
1198122831 X:133610934-133610956 TCTGTCTTCCCCTGTAAAGTCGG - Intronic
1198967728 X:142244906-142244928 TAGGGGTAGCACTGGAAAGTGGG - Intergenic
1200809466 Y:7467732-7467754 GAAGGCTTCCACTCAAAAGTAGG - Intergenic
1201762186 Y:17552722-17552744 TAGGGTTTTCACTGAAAATTGGG + Intergenic
1201839366 Y:18353266-18353288 TAGGGTTTTCACTGAAAATTGGG - Intergenic