ID: 957089057

View in Genome Browser
Species Human (GRCh38)
Location 3:75710151-75710173
Sequence ATGGATACACAGTTTAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 3, 1: 0, 2: 2, 3: 49, 4: 469}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957089057 Original CRISPR ATGGATACACAGTTTAAAAA GGG Intronic
901574518 1:10190074-10190096 AAGGATAGATAGTTTACAAAGGG - Intergenic
902065566 1:13683095-13683117 AAGAATAGACAGTTTAGAAATGG + Intergenic
902356161 1:15902347-15902369 ACAGATACACAGTTGAAATAGGG + Intronic
903103762 1:21055249-21055271 ATGAATACACATTTTTAACACGG + Intronic
903108233 1:21103984-21104006 ATGATTACACAGTTTACTAAGGG - Intronic
903165200 1:21515400-21515422 AGCGATACTCAGTCTAAAAAAGG - Intronic
903197263 1:21700109-21700131 ATGCACACAGAGTTTAATAAGGG + Intronic
904067076 1:27761649-27761671 ATGAATGAACAGATTAAAAATGG + Intronic
904683756 1:32246676-32246698 TTGAAAACAAAGTTTAAAAAAGG + Intergenic
905121336 1:35684361-35684383 AGAGATAGACAGTTCAAAAAAGG - Intergenic
905456576 1:38092313-38092335 AAGGAGACACAGTTAGAAAAGGG + Intergenic
905606197 1:39302385-39302407 ATGGAAAAAAAATTTAAAAATGG + Intronic
905671972 1:39797506-39797528 ATGGATACACAGTTTCAGTTTGG + Intergenic
905984100 1:42261295-42261317 ATGTATAGACAGGGTAAAAAGGG + Intronic
906233284 1:44184325-44184347 ATAGATATAAAGTTTTAAAAGGG + Intergenic
906385743 1:45367286-45367308 ATGCATACACAGCTGAAAGAAGG + Intronic
906848790 1:49224787-49224809 AGGGATTCACAGTCCAAAAATGG + Intronic
907206534 1:52776883-52776905 ATAAATAGAAAGTTTAAAAAGGG + Intronic
907381290 1:54092598-54092620 AGGCATGCACAGTTTAGAAATGG + Intronic
907676924 1:56526468-56526490 ATGTATAAACAGGTTCAAAAGGG - Intronic
907739240 1:57148105-57148127 ATGGAGAGACAGCTTGAAAATGG + Intronic
909135527 1:71794931-71794953 ATGAATGCACAATTTTAAAAAGG + Intronic
909238566 1:73182558-73182580 TAGAAAACACAGTTTAAAAATGG - Intergenic
909646906 1:77927688-77927710 ATGGTTACACAGTTAGTAAATGG - Intronic
909887114 1:80956155-80956177 ATATATAGACATTTTAAAAAGGG - Intergenic
910297759 1:85668343-85668365 ATGGATACCAAGTTGATAAATGG - Intronic
910959015 1:92741004-92741026 TTGGAAACAAAGTTTCAAAAAGG + Intronic
911775735 1:101809647-101809669 ATGGAAACACAGTTCCAAGAGGG + Intronic
913053510 1:115137220-115137242 AAGATGACACAGTTTAAAAAGGG + Intergenic
913532579 1:119743210-119743232 GTGGATACTCAGTTCAAAGAGGG + Intronic
914419370 1:147514827-147514849 AAGGATTCACAGTTTGTAAACGG - Intergenic
915491499 1:156252420-156252442 CTGGAGGCAGAGTTTAAAAAAGG - Exonic
915808226 1:158877095-158877117 GAGGATACACAGTTTCTAAAAGG - Intergenic
917109352 1:171529215-171529237 AAGGATACAGATTTTTAAAATGG - Intronic
917557392 1:176104094-176104116 ATGGATAAACTTTTTAAAATAGG + Intronic
917819859 1:178751519-178751541 ATTGATAACCAGTTTAGAAAAGG - Intronic
917834048 1:178926748-178926770 ATGAATAGACAATTTATAAAGGG + Intergenic
917899364 1:179526915-179526937 AGGCATTCTCAGTTTAAAAATGG + Intronic
918394914 1:184103725-184103747 ATGGATACAGAGTTTAATTTTGG - Intergenic
918451992 1:184667982-184668004 GCAGATACAAAGTTTAAAAAGGG - Intergenic
919422590 1:197389201-197389223 CTGGATACACACCTTAAAGAGGG + Intronic
920064130 1:203253639-203253661 ATGGATATGCAATATAAAAAAGG - Intronic
920679524 1:208061995-208062017 TTGTATACACAGTTGTAAAAAGG + Intronic
921437809 1:215147345-215147367 ATGGATCCTTAGTTTAAAACTGG + Intronic
922050472 1:221984939-221984961 ATGAATCAGCAGTTTAAAAATGG + Intergenic
922375003 1:224954133-224954155 ATGGATAGACATTTTAATGAAGG + Intronic
922916479 1:229262107-229262129 ATGGAGACACAGATGAGAAAGGG - Intergenic
924221657 1:241882467-241882489 ATGGGTACACAGTTTCTAGAAGG - Intronic
924827085 1:247550890-247550912 ATGGAAGCAAATTTTAAAAATGG + Intronic
1063497623 10:6524939-6524961 ATAGAAATACTGTTTAAAAAGGG + Intronic
1063979596 10:11443003-11443025 ATGGAAACACAGGTCAAATAAGG + Intergenic
1064508776 10:16065799-16065821 AGAGAAACACAATTTAAAAATGG - Intergenic
1064648060 10:17480342-17480364 CTGGATCCACAGTCTAAAATAGG - Intergenic
1064909123 10:20381358-20381380 AAGGCTACTTAGTTTAAAAATGG - Intergenic
1065581661 10:27178089-27178111 ATTGATACAAATATTAAAAATGG + Intronic
1065666489 10:28068625-28068647 ATGGCTATATAGTTTAAATATGG - Intronic
1066313042 10:34216902-34216924 ATGGGGACAGAGTTTAAAGATGG - Intronic
1066523045 10:36243944-36243966 ATGAATAGACAGTTTTCAAAAGG + Intergenic
1067241153 10:44495434-44495456 AAAGATACACATGTTAAAAAGGG + Intergenic
1068212471 10:53938582-53938604 TTGGATACACAATTTGAAAACGG + Intronic
1068281257 10:54873147-54873169 ATTGATACACTTTCTAAAAAGGG + Intronic
1068371373 10:56120374-56120396 ATTGATACTCAGTTTTAAATGGG + Intergenic
1068389160 10:56370853-56370875 TTTTATACACACTTTAAAAAGGG - Intergenic
1068554664 10:58446080-58446102 ATGGAAACTCATTTTAAAAATGG - Intergenic
1069007531 10:63335284-63335306 CTGGATACCCTGTTTAAAAATGG + Intronic
1069067419 10:63958157-63958179 ATTTATATAAAGTTTAAAAATGG - Intergenic
1069480750 10:68779603-68779625 AAGGTAACACAGTTTAACAAGGG + Intronic
1071048370 10:81413824-81413846 ATGGATTCACAGTTGAATATGGG - Intergenic
1071698688 10:87905161-87905183 TTGGCTATTCAGTTTAAAAAAGG + Intronic
1072103386 10:92250659-92250681 AAGGATACATATATTAAAAAAGG - Intronic
1072549627 10:96467756-96467778 ATACATACACAGTTTAAAAAAGG + Intronic
1073516693 10:104082237-104082259 CTTCATACACAGTTTAACAAAGG + Intronic
1073562480 10:104508780-104508802 ATGGGTACACAGTTTACACTTGG - Intergenic
1074206959 10:111291039-111291061 ATTCATCCACAGTTGAAAAAAGG + Intergenic
1078500092 11:11864700-11864722 ACACATACACAGTTTCAAAAAGG - Intronic
1079686054 11:23361167-23361189 ATGGAAACACAGTTTCCCAAAGG - Intergenic
1079783250 11:24637018-24637040 GTTGATTAACAGTTTAAAAAGGG + Intronic
1079816937 11:25073030-25073052 TTTTATACACACTTTAAAAAGGG + Intronic
1080228923 11:29994208-29994230 ATTGATTCAAAGTTTTAAAAGGG + Intergenic
1080280069 11:30546607-30546629 ATGGCCACACACTTTAAAGAAGG - Intronic
1080375288 11:31702409-31702431 ATGGATACAGAGTTTCAATTTGG + Intronic
1080376682 11:31721503-31721525 TTGAATACACAGTTTTAGAAAGG - Intronic
1081053877 11:38383906-38383928 TTTGATACACAGTTTTATAATGG - Intergenic
1082641302 11:55664909-55664931 ATAGAAACACAATTTAGAAAGGG + Intergenic
1082725396 11:56728662-56728684 ACAGCTACAAAGTTTAAAAAAGG + Intergenic
1083971658 11:66080605-66080627 AAGACTACACAGTTTAAAAGTGG + Intronic
1085191221 11:74625052-74625074 AACAATACACAGTTTACAAATGG - Intronic
1085437015 11:76515018-76515040 ATGGATACATAGTTTGAATTTGG - Intronic
1086068720 11:82775367-82775389 AAGGCAACACAGTTTTAAAATGG + Intergenic
1086795857 11:91101291-91101313 ATGCATACACAGTTCACAATAGG - Intergenic
1088003871 11:104917016-104917038 ATGGATACACATATTTCAAAAGG + Intergenic
1089978589 11:122753879-122753901 ATGGATAGACAGTTTAGATAGGG - Intronic
1091234358 11:134010414-134010436 ATTTATACACAATTTACAAAGGG + Intergenic
1092705716 12:11282245-11282267 ATGAATACACAGTTCTTAAAGGG + Intergenic
1092734579 12:11568247-11568269 AAGGATGCAGAGTTTATAAAGGG - Intergenic
1092842122 12:12552543-12552565 ACGGATACATAGTTGAAGAAGGG - Intronic
1093050456 12:14498552-14498574 ATGGCTAAATAGTTTAAAATAGG + Exonic
1094042045 12:26128451-26128473 ATGGAAGTACAGTTTAGAAAAGG + Intronic
1094270994 12:28614316-28614338 ATAGATACACATTTAAAACATGG + Intergenic
1095245705 12:39918709-39918731 ATGTATTCACAGTTTAAGAAAGG + Intronic
1095246034 12:39922525-39922547 AAGGATAAACAGCTGAAAAATGG + Intronic
1095427340 12:42090983-42091005 ATGAATTCACACTTTAAAGATGG + Intronic
1096308530 12:50500175-50500197 AGGGATACATTGTTTAAATAAGG - Intergenic
1098688740 12:73459531-73459553 ATGGACTCACAGTTTATAAATGG - Intergenic
1098699124 12:73600468-73600490 ATCTTTGCACAGTTTAAAAATGG - Intergenic
1099066718 12:77989946-77989968 TTGGATACTCATTTTAAAAAAGG - Intronic
1099080912 12:78179344-78179366 ATGCATTCACAGGTTCAAAACGG - Intronic
1099141357 12:78980340-78980362 ATGGAGACAAGGTCTAAAAAGGG + Intronic
1099211670 12:79798851-79798873 ATGGAACCACATTTTTAAAAAGG + Intronic
1099830985 12:87842472-87842494 TCAGATACAAAGTTTAAAAAGGG - Intergenic
1099853471 12:88134620-88134642 ATGGTTGCACAGCTTATAAATGG - Intronic
1100069830 12:90700993-90701015 ATGGATACAATTTTTAAAATAGG - Intergenic
1101073056 12:101096742-101096764 ATTTATACAAAGTGTAAAAAGGG + Intronic
1101394354 12:104331520-104331542 ATAGTCACACTGTTTAAAAATGG - Exonic
1101703230 12:107195037-107195059 ATGGGTACACAGTTTCCATATGG - Intergenic
1101749927 12:107575180-107575202 AGGGCCACACAGTTTACAAAGGG + Intronic
1102251762 12:111392143-111392165 AAGGACACACAGTTTGCAAATGG - Intergenic
1102787783 12:115618519-115618541 ATGGATACAGAGTTTCAATTTGG + Intergenic
1103189974 12:118992935-118992957 ATGTATTCACATTTTACAAACGG + Intronic
1104261928 12:127192505-127192527 TTAGATATACATTTTAAAAAAGG - Intergenic
1105648016 13:22342199-22342221 AAGGATTCACTGTTTATAAATGG + Intergenic
1106401015 13:29430900-29430922 GTTGATACACAGTTTAAAAGAGG + Intronic
1106520653 13:30494757-30494779 ATGGATACAGAGTTTTAATTGGG - Intronic
1106938894 13:34754453-34754475 ATGGAAACACTCGTTAAAAAAGG - Intergenic
1107105835 13:36641636-36641658 AAGGATGAAAAGTTTAAAAAGGG - Intergenic
1107192187 13:37602436-37602458 CTGTATGCATAGTTTAAAAAGGG - Intergenic
1107488787 13:40859600-40859622 TTGGATACTCTGATTAAAAATGG + Intergenic
1107914321 13:45133809-45133831 TTTTATACACACTTTAAAAAGGG - Intronic
1108628983 13:52262224-52262246 CTGGATACTCTGATTAAAAATGG + Intergenic
1108657072 13:52544242-52544264 TTGGATACTCTGATTAAAAATGG - Intergenic
1108694427 13:52890309-52890331 ATGGGTATACAGTTTCAATATGG - Intergenic
1108962323 13:56249228-56249250 TTGGATACACAATTAAATAAAGG - Intergenic
1109332885 13:60952084-60952106 ATGAATATAAAGTTTAAAATTGG + Intergenic
1109351030 13:61181408-61181430 ATGGATAAACAGTTTATCCAAGG - Intergenic
1109404104 13:61875231-61875253 ATTTATACACACTTTAAAAAGGG + Intergenic
1109792036 13:67261632-67261654 ATGGAGAAAAATTTTAAAAATGG + Intergenic
1109943415 13:69401201-69401223 TTAGATATAAAGTTTAAAAAAGG - Intergenic
1110000905 13:70198634-70198656 ATTGATACAAATCTTAAAAATGG + Intergenic
1110197419 13:72806228-72806250 ATAGAAACAAAGTTAAAAAATGG - Intronic
1112629936 13:101149402-101149424 TTGTTTACACATTTTAAAAATGG + Intronic
1113059328 13:106304737-106304759 ATGAAGACACAGGTTAAAAGTGG + Intergenic
1113243797 13:108371199-108371221 ATGGAATCACAGGTTGAAAAGGG - Intergenic
1114075580 14:19159526-19159548 ATGGATAAACAGTTTACAGATGG - Intergenic
1114086581 14:19240046-19240068 ATGGATAAACAGTTTACAGATGG + Intergenic
1115286625 14:31721143-31721165 ATAGTTACACACTTTACAAAAGG - Intronic
1115982316 14:39067198-39067220 ATGCATGGACAGTTTAAAATGGG - Exonic
1116057183 14:39877975-39877997 TTGAAGACACAGTTTAAGAATGG - Intergenic
1116959840 14:50957616-50957638 ATTTATACAAAGTTTAAAACTGG - Intergenic
1117335471 14:54753893-54753915 ATGGTTTCTCAATTTAAAAATGG - Intronic
1118120817 14:62840144-62840166 ATGAATGCAAATTTTAAAAATGG + Intronic
1118542572 14:66844840-66844862 ATGGGTACAGAGTTTCTAAATGG - Intronic
1121177684 14:91903474-91903496 ATGAGTACTCAGTTAAAAAAGGG - Intronic
1123103348 14:105820669-105820691 ACAGATACAAAGTTTAAAAAGGG + Intergenic
1202898118 14_GL000194v1_random:21664-21686 ATGGATAAACAGTTTACAGATGG + Intergenic
1124167817 15:27343760-27343782 AAGGAAACAAAATTTAAAAAAGG + Intronic
1124571162 15:30865315-30865337 ATGGGTACAAAGTTGACAAAGGG - Intergenic
1124692217 15:31833452-31833474 CTGGATACAGATTTTATAAATGG - Intronic
1125093521 15:35824526-35824548 AGGGAAAAACAGCTTAAAAAAGG + Intergenic
1125192475 15:37009850-37009872 ATAGATACACAGAGTAAATATGG + Intronic
1125287237 15:38106585-38106607 AAGGACACACAGTTTATAAGAGG + Intergenic
1125886611 15:43234388-43234410 AAGGATACACAGCCAAAAAATGG + Intronic
1126193636 15:45905541-45905563 ACAGATACAAAGTTTAAAAAGGG + Intergenic
1127980459 15:64031087-64031109 ATGGTCACACACTTTAAACAAGG - Intronic
1128106269 15:65047382-65047404 ATATATACACACATTAAAAATGG + Intronic
1128275812 15:66352790-66352812 ATGTATAGAGAGTTTTAAAAAGG - Intronic
1130128500 15:81115581-81115603 ACAGATCCAAAGTTTAAAAAGGG + Intronic
1130616375 15:85412312-85412334 ATAGATACCCAATTTGAAAAAGG - Intronic
1131655970 15:94459258-94459280 ATGGGTAAACAGATTAAAAGTGG + Intronic
1132526361 16:417534-417556 ATGGATACACAGTTGACACAAGG + Intergenic
1132957423 16:2602505-2602527 TGGGTTACACAGCTTAAAAAAGG - Exonic
1132969759 16:2680920-2680942 TGGGTTACACAGCTTAAAAAAGG - Intergenic
1134160672 16:11886274-11886296 ATGACAACCCAGTTTAAAAATGG + Intronic
1134331790 16:13258294-13258316 AAGGACACACAGTTAACAAATGG - Intergenic
1134368421 16:13600732-13600754 ATGGCTACACATATTATAAAAGG - Intergenic
1135322086 16:21503711-21503733 ATGCATACACATTTTTTAAAAGG + Intergenic
1136333563 16:29596852-29596874 ATGCATACACATTTTTTAAAAGG + Intergenic
1137243429 16:46680013-46680035 ATGAATAAACTTTTTAAAAAAGG + Intronic
1137967341 16:52949158-52949180 ATGGTTACAGAGTTTCAGAAGGG + Intergenic
1138003162 16:53303602-53303624 ATGGAGGCACATTTTAGAAATGG + Intronic
1139068517 16:63350262-63350284 ATGGATAGACAATCTTAAAAGGG + Intergenic
1141037254 16:80638759-80638781 ATGGATATCCATTTGAAAAAGGG + Intronic
1142545560 17:699812-699834 ATGGATAAACATTTTACTAACGG + Intronic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1146386566 17:32381902-32381924 CTGGATACAAATTTAAAAAATGG - Intergenic
1146992985 17:37292553-37292575 AAGGATAAAGAGTTTAAGAAAGG + Intronic
1147484966 17:40804031-40804053 AAGGATACACAGTGTGAAACGGG + Intergenic
1149803989 17:59597180-59597202 ATTTATACAAAGGTTAAAAATGG + Intronic
1149842507 17:59978298-59978320 ATTTATACAAAGGTTAAAAATGG - Intergenic
1149980257 17:61305063-61305085 ATGAATAAACACTTTAGAAAAGG - Intronic
1150115355 17:62543667-62543689 AAGGCAACACAATTTAAAAATGG - Intronic
1150348942 17:64426858-64426880 CTGAATACACAGTTTACATAAGG - Intergenic
1151016394 17:70558653-70558675 ATGCATACATATTTTAAAGATGG + Intergenic
1152592532 17:81220808-81220830 AAAAATACACATTTTAAAAAGGG + Intronic
1153717126 18:7861053-7861075 AGGGACATACAGTGTAAAAAGGG - Intronic
1153974840 18:10259906-10259928 ATGAGGACACAGTTTAAATATGG - Intergenic
1154166558 18:12019159-12019181 ATAGATACGTAGTTTAAAAAAGG + Intronic
1154466457 18:14646985-14647007 ATGAATTCAATGTTTAAAAATGG + Intergenic
1155652423 18:28158057-28158079 ATGGTTTCACTTTTTAAAAATGG + Intronic
1155912628 18:31522272-31522294 AAGGATAGAGAGTTTAAAGATGG - Intronic
1156178664 18:34577319-34577341 ATTGATTGAAAGTTTAAAAATGG - Intronic
1156202334 18:34848541-34848563 GTGAATTTACAGTTTAAAAATGG + Intronic
1156276950 18:35592881-35592903 AGGGATTCACAGTCTAAAAGGGG - Intronic
1156864218 18:41870827-41870849 ATGGATTGACAGTTTAGAATGGG - Intergenic
1158161783 18:54493186-54493208 CCATATACACAGTTTAAAAATGG + Intergenic
1158965401 18:62618029-62618051 ATGGATACACAGTTTCAGTTTGG + Intergenic
1160126490 18:76177423-76177445 ACAGATACAAAGTTTAAAAGGGG + Intergenic
1160547319 18:79668186-79668208 ACAGATACAAAGTTTAAAAAGGG - Intergenic
1162339019 19:10080267-10080289 ATGGATACCCAGTTTATAAGTGG - Intergenic
1163896148 19:20061479-20061501 ATGAATACATAGTTCAAAAGGGG + Intergenic
1163918670 19:20266666-20266688 ATGAATACATAGTTCAAAGAGGG + Intergenic
1163930333 19:20384267-20384289 ATGAATACATAGTTCAAAGAGGG - Intergenic
1165499322 19:36175321-36175343 ATGCATACATATCTTAAAAATGG + Intergenic
1167405376 19:49303805-49303827 ACAGATACAAAGTTTTAAAAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168368081 19:55806623-55806645 CTGGATACCGCGTTTAAAAATGG - Intronic
925336073 2:3100229-3100251 TTGCATACACATTTTAAAAAAGG - Intergenic
925973851 2:9126953-9126975 ATGGATACAGAGTTTCTACATGG + Intergenic
926445861 2:12942174-12942196 AAGGATGAATAGTTTAAAAATGG + Intergenic
926611664 2:14953832-14953854 ATGGATAAAAAGTTATAAAAAGG + Intergenic
928968898 2:37006121-37006143 ATGCATACAAAGTTTTTAAATGG + Intronic
929327923 2:40640274-40640296 ATGGATACAAAGTCTAAAAGAGG - Intergenic
929964832 2:46526501-46526523 ATGGATACAGAGTTTAAATTTGG - Intronic
930260078 2:49135369-49135391 ATGGATACATTTTTTAAAAAAGG + Intronic
930356101 2:50322452-50322474 ATGCAAACACATTTTAAACAAGG + Intronic
930544932 2:52755285-52755307 ATAGATACAAAATGTAAAAAAGG + Intergenic
930993465 2:57687351-57687373 AGGGTTACATAGTGTAAAAAGGG + Intergenic
931017026 2:57994056-57994078 ATGGAGACATCCTTTAAAAAGGG - Intronic
931268918 2:60684816-60684838 CTGAAGAAACAGTTTAAAAATGG + Intergenic
931955743 2:67422231-67422253 ATGGAAAAATAATTTAAAAAGGG - Intergenic
932504948 2:72219907-72219929 ATGGAGACACAGTTGAAGACGGG + Intronic
932695284 2:73951173-73951195 ATGGCATCACAGTTCAAAAAAGG - Intronic
932932222 2:76055836-76055858 ATGTATATATAGTTTAAAATTGG + Intergenic
933079844 2:77972259-77972281 ATGGCTTCACAGATGAAAAATGG - Intergenic
933351294 2:81155236-81155258 ATGTCTACATAGTTTAAAATGGG - Intergenic
933469414 2:82702261-82702283 CAGGATACACAGTTCCAAAAGGG + Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
934160539 2:89245201-89245223 AAAAATACACAGTTTCAAAATGG + Intergenic
934558532 2:95300265-95300287 CTGGATCCACAGTCCAAAAATGG - Intronic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
934990556 2:98917643-98917665 ATGTATACACATTTTTAAAAAGG - Intronic
935241538 2:101182650-101182672 ATGAAAACCCATTTTAAAAATGG - Intronic
936257687 2:110930860-110930882 ATGGACACACAGTTTCACAAGGG - Intronic
936559905 2:113528392-113528414 AAGGAGTCACAGTTTTAAAATGG - Intergenic
937187917 2:120063430-120063452 TTGGAAACACACTTTAAAAAGGG - Intronic
937699600 2:124849233-124849255 AAGAATACACAATGTAAAAAAGG - Intronic
937710789 2:124978054-124978076 AAGGTCACACCGTTTAAAAATGG - Intergenic
938490170 2:131757026-131757048 ATGGATAAACAGTTTACAGATGG - Intronic
940496544 2:154436406-154436428 AAGAATACACTGTATAAAAACGG + Intronic
941790211 2:169544267-169544289 ATGGATACAAAGTTTTTATAGGG + Intronic
942051336 2:172143785-172143807 TTGGCTACTCAGTTGAAAAAGGG + Intergenic
942653301 2:178191025-178191047 AGGGAGACTCTGTTTAAAAAAGG + Intergenic
943928948 2:193824684-193824706 ATGGATGCACAGTGAAACAATGG + Intergenic
944247782 2:197549476-197549498 GTGTATACATATTTTAAAAAAGG + Intronic
944916146 2:204362669-204362691 ATGGAGACAAAGTTTGAATAAGG + Intergenic
945156462 2:206845006-206845028 ATGTATATACAATTTAAAGAGGG - Intergenic
945178975 2:207072250-207072272 ATGTATACACATTTTAAAACAGG - Intergenic
946608814 2:221436239-221436261 TTGGAAACATGGTTTAAAAATGG + Intronic
946774055 2:223119214-223119236 ATGCACACACAGCTTCAAAAGGG + Intronic
946811311 2:223528973-223528995 ATGAAAAGACAGTTTTAAAAGGG - Intergenic
946988869 2:225304960-225304982 ATTGATACACAACTTACAAAAGG - Intergenic
947436296 2:230075283-230075305 ATAAATAAACATTTTAAAAAAGG + Intergenic
948165614 2:235859569-235859591 ATGGAAATACAGTTAGAAAAGGG - Intronic
1169500403 20:6154779-6154801 ATAGATAGATAGATTAAAAAAGG - Intergenic
1169580297 20:7015284-7015306 ATGGATACACAGATCACAAATGG - Intergenic
1170822509 20:19766361-19766383 ATGGAAGCACAGTTTAAAAGAGG - Intergenic
1172724970 20:37032426-37032448 ATGGATACAGAATTTCAGAATGG + Intronic
1174281038 20:49439508-49439530 AAGGGTACACAGTTAAAAAGGGG + Intronic
1176617802 21:9037653-9037675 ATGGATAAACAGTTTACGGATGG + Intergenic
1176808136 21:13511612-13511634 ATGAATTCAGTGTTTAAAAATGG - Intergenic
1177046546 21:16177564-16177586 ATGGTAATACAGTCTAAAAAAGG - Intergenic
1177861563 21:26460408-26460430 ATGTGTACACAGTACAAAAAAGG + Intergenic
1178034848 21:28569083-28569105 AATGATATAAAGTTTAAAAAGGG - Intergenic
1178498469 21:33106485-33106507 ATGGTTACAAAATTTTAAAAAGG + Intergenic
1179639918 21:42740647-42740669 ATGGATAGATAGTATATAAATGG + Intronic
1180291282 22:10852692-10852714 ATGGATAAGCAGTTTACAGATGG - Intergenic
1180494087 22:15882114-15882136 ATGGATAAGCAGTTTACAGATGG - Intergenic
1182345508 22:29661193-29661215 TTGGATCCACAGAATAAAAAGGG + Exonic
1184971678 22:48026780-48026802 ATGTATGCTCAGTTTAAAGATGG - Intergenic
1185136463 22:49076183-49076205 ATGTATTCACAGTTTTACAAAGG + Intergenic
950092900 3:10309442-10309464 AAGGATAAACAGTGTGAAAAAGG - Intronic
951358118 3:21693528-21693550 AAGTGTACACAGCTTAAAAATGG - Intronic
952292907 3:32035913-32035935 ATGGATACAGAGTTTCAATTTGG - Intronic
952456039 3:33472758-33472780 ACAGATACAAAGTTTAAAAATGG + Intergenic
953094223 3:39759041-39759063 ATCTATACAGTGTTTAAAAAAGG + Intergenic
953230742 3:41062807-41062829 GTGGATACATTGTATAAAAATGG + Intergenic
954889755 3:53914283-53914305 CTGAATACACAATTTAAATATGG - Intergenic
954892156 3:53940631-53940653 ATAAATGCACAGTTTAGAAATGG + Intergenic
955134859 3:56206777-56206799 ACGGATACACTGTTCACAAATGG - Intronic
955641480 3:61090359-61090381 TTGCATACACAGTTGAAATATGG - Intronic
956196280 3:66656257-66656279 ATGGAGATGCAGTTTAAAATAGG - Intergenic
957089057 3:75710151-75710173 ATGGATACACAGTTTAAAAAGGG + Intronic
957447524 3:80333559-80333581 AAGGATACCCTATTTAAAAATGG - Intergenic
957498845 3:81027118-81027140 AAGAAGACACACTTTAAAAATGG - Intergenic
957778675 3:84789824-84789846 ATGTAAACACAATATAAAAATGG + Intergenic
957792336 3:84958110-84958132 ATGCGTACATACTTTAAAAATGG - Intergenic
959327870 3:104960631-104960653 ATGCAAATACATTTTAAAAATGG - Intergenic
959389530 3:105757527-105757549 ATGGATACATACTGTAAACATGG + Intronic
959979540 3:112500021-112500043 ATGTATCCACAGATTAAAGACGG - Intergenic
960197546 3:114788322-114788344 ATGGTTACACAGTTTGAATATGG - Intronic
960592543 3:119379711-119379733 ATCAATACATACTTTAAAAAGGG - Intronic
961408529 3:126701099-126701121 ATAAATACCCAATTTAAAAATGG - Intergenic
961504996 3:127364213-127364235 ATGGCTACAATTTTTAAAAAAGG - Intergenic
962235925 3:133706931-133706953 ATGAAGACACAATTTAAAGAAGG - Intergenic
964220111 3:154333762-154333784 ATGGTTTCACAGATTACAAAAGG + Intergenic
964282485 3:155081100-155081122 CTGCAGACACAGTTTAAATATGG + Intronic
965031921 3:163381245-163381267 ATGCAAATACAATTTAAAAAAGG + Intergenic
965169486 3:165243354-165243376 ATAGTTACAAAGTTTAAAAAGGG + Intergenic
965724289 3:171697698-171697720 ATGGACAAACATTTTTAAAAGGG - Intronic
965899686 3:173623311-173623333 GTGCATACATAGTGTAAAAATGG + Intronic
965973553 3:174592722-174592744 ATTGTTACACAGATTAATAATGG - Intronic
966201676 3:177365038-177365060 ATGCATCCACAGTTTGAAGACGG + Intergenic
967498469 3:190169103-190169125 CTGAATCTACAGTTTAAAAAAGG + Intergenic
967735827 3:192951393-192951415 AAGGATGCACATTTTAACAAAGG + Intergenic
967987172 3:195104066-195104088 ATGGACCCACAGTTTAGAATGGG + Intronic
971014529 4:22474180-22474202 TTGAATACACATTTTTAAAATGG + Intronic
971590609 4:28463775-28463797 ATAATTCCACAGTTTAAAAAAGG - Intergenic
971686290 4:29773537-29773559 ATAGAGATAAAGTTTAAAAATGG - Intergenic
971700923 4:29974238-29974260 ATGAAGACACAGTGTAAGAAAGG - Intergenic
971928498 4:33047225-33047247 ATGTAAACTCAGGTTAAAAATGG + Intergenic
971974177 4:33662123-33662145 ATTAATACATATTTTAAAAAAGG - Intergenic
972066369 4:34950884-34950906 ATTGATACACAGATATAAAAAGG - Intergenic
972361089 4:38326038-38326060 ATAGACACACAGGTTCAAAAAGG + Intergenic
972649052 4:40998533-40998555 ACAGATACATAGGTTAAAAAGGG - Intronic
973043476 4:45504502-45504524 TGGGATACACATTTTAAAATAGG - Intergenic
973563833 4:52163701-52163723 CTGGAGATACACTTTAAAAATGG + Intergenic
973664430 4:53142909-53142931 TTGGATATACACTTTAAACAGGG - Intronic
974348502 4:60714184-60714206 AGGCATACACAATTTACAAAAGG + Intergenic
974558014 4:63477663-63477685 AGGGAAGCAAAGTTTAAAAAAGG + Intergenic
974614148 4:64260086-64260108 ATGGAGAAACACTTTAAATATGG + Intergenic
974977429 4:68907237-68907259 TTTTATACACACTTTAAAAAAGG + Intergenic
974979928 4:68942791-68942813 ATGGATACAACGTTTAAATTTGG + Intronic
975082550 4:70298582-70298604 ATGGAAAAACAATCTAAAAAAGG + Intergenic
975468438 4:74735977-74735999 ATGGATGCGCAGTGTAAAATTGG + Intergenic
976735788 4:88307616-88307638 ACAAATACAAAGTTTAAAAAGGG + Intergenic
976757161 4:88510852-88510874 ATGAAGACACAATTTTAAAATGG + Intergenic
976886469 4:89990854-89990876 ATTAATACAGAATTTAAAAAAGG - Intergenic
977311418 4:95392342-95392364 ATGCTTACTCAGTTTTAAAATGG + Intronic
977541869 4:98327948-98327970 ACAGATACAAAGTTTAAGAAAGG + Intronic
977673724 4:99725142-99725164 ATGTATACACACATTGAAAAAGG - Intergenic
977769875 4:100845702-100845724 ATGGATTCATAGTCTACAAAGGG + Intronic
979627429 4:122861267-122861289 ATGAATCCAGAGTTCAAAAAAGG - Intronic
979754998 4:124329135-124329157 ATGCTTTCTCAGTTTAAAAATGG + Intergenic
980505399 4:133712533-133712555 ATTTTTACATAGTTTAAAAAGGG - Intergenic
982418081 4:155160719-155160741 ATAGATACGAAGTTTTAAAAGGG - Intergenic
982555346 4:156855019-156855041 ATGAATAAAAAATTTAAAAAAGG + Intronic
982706726 4:158718226-158718248 ATTGATGCAGAATTTAAAAAGGG - Intronic
983472837 4:168177429-168177451 GTGGATACTCAGTTTGATAAGGG + Intronic
983595184 4:169458221-169458243 ATGGATACAGAGTTCAGAAATGG + Intronic
983863177 4:172733808-172733830 ATTTATTCACAGTATAAAAATGG + Intronic
984032064 4:174616489-174616511 TTAGATACAGAATTTAAAAATGG - Intergenic
984674554 4:182531859-182531881 GTGCATAAACAGTTTAAACATGG + Intronic
986115062 5:4765621-4765643 GTGGATACACTTTTTATAAAAGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986638492 5:9848880-9848902 ATGGAAACAGACTTAAAAAACGG - Intergenic
987303729 5:16618585-16618607 TTGGATGCACAGTTTAAGTAAGG - Intergenic
987348470 5:16999556-16999578 AGAGATACACAGTTTAAATTTGG + Intergenic
987418625 5:17692031-17692053 TTGAAGACACAGTTTAAAACCGG + Intergenic
987518650 5:18949050-18949072 AAAGATACAGAGTTGAAAAATGG + Intergenic
987904488 5:24058369-24058391 CTGAATACACAGTTGAGAAAAGG + Intronic
987986698 5:25156264-25156286 ATGGAAACACAGTAAAGAAAAGG + Intergenic
988015338 5:25550127-25550149 ATAGATACTAAATTTAAAAAAGG - Intergenic
988392501 5:30653778-30653800 AAGGCAACACAGTTAAAAAATGG - Intergenic
989726134 5:44588782-44588804 GTGGAAACATAGTCTAAAAATGG + Intergenic
990195559 5:53311194-53311216 ATGAACAGACAGTTTGAAAAAGG + Intergenic
990471282 5:56118205-56118227 CTGGTTATACAGTTTAATAAAGG - Intronic
991137499 5:63199409-63199431 ATGGATAGAGAGCTTAAAGATGG - Intergenic
991567289 5:68018708-68018730 ATGGAAACACAGAGTAAAAGTGG + Intergenic
992169216 5:74085687-74085709 ATGAATATACAGATTATAAATGG - Intergenic
992298656 5:75353990-75354012 ATGGATACACAGTGAAACAGTGG + Intronic
993448743 5:88047303-88047325 ATGAATAAACAGGTTAAATATGG + Intergenic
993675219 5:90808518-90808540 CTGGATGAACATTTTAAAAATGG - Intronic
994651500 5:102534751-102534773 ATGGATACAGAGTTTCAATCTGG + Intergenic
994668690 5:102739501-102739523 ATGGATGTATAGTTGAAAAAGGG + Intergenic
996168236 5:120253366-120253388 AAAAATACACATTTTAAAAAAGG + Intergenic
996222153 5:120947435-120947457 ATATATACAAAGTTTATAAAGGG + Intergenic
996864248 5:128101709-128101731 ACTGATACACACTTTACAAAAGG - Intronic
997005579 5:129813222-129813244 AGGGAGACACAGTTGAAAGATGG - Intergenic
997227039 5:132216783-132216805 ATGCATATACATTTAAAAAATGG - Intronic
998283944 5:140840163-140840185 ATGTATACAAATTTTAAATATGG + Intronic
998363907 5:141616175-141616197 ATGGACCCTCAGTTTAAAAGTGG - Intronic
998610476 5:143682849-143682871 AAGGATAAACAGTTTCATAATGG + Intergenic
998801111 5:145870196-145870218 ATGGATACAGAGTTTCAATTTGG - Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999794555 5:154976943-154976965 ATGGATACAGAGTTTCAGATGGG - Intergenic
1000669694 5:164045712-164045734 GTGGATAAACAGTTTAACAGTGG - Intergenic
1001265705 5:170273077-170273099 ATGGATACCCCATTTTAAAAAGG - Intronic
1001976557 5:176004897-176004919 ATGGATACATTGTTTTAAGAAGG - Intronic
1002035638 5:176467248-176467270 ATGGATACAAAGGTTAACTATGG - Intronic
1002240870 5:177838875-177838897 ATGGATACATTGTTTTAAGAAGG + Intergenic
1002803977 6:553803-553825 GTTGTTACACAGTTTTAAAATGG + Intronic
1003228133 6:4224929-4224951 TTTTATACACACTTTAAAAAGGG - Intergenic
1003861045 6:10322023-10322045 TTGGAAGCACAGGTTAAAAAGGG - Intergenic
1004001794 6:11602893-11602915 CGGGAAACACAGTTTGAAAAAGG - Intergenic
1005519332 6:26584835-26584857 GAGAATAAACAGTTTAAAAAAGG + Intergenic
1006584908 6:35102918-35102940 ACAGATACACAGTTTAAAAAGGG - Intergenic
1007124908 6:39417874-39417896 AGGGAGAAACAGTTTATAAAAGG + Intronic
1007844719 6:44743697-44743719 ATGAATACATATCTTAAAAATGG + Intergenic
1007995179 6:46299862-46299884 ATGTATATATATTTTAAAAATGG - Intronic
1008217974 6:48818932-48818954 ATGGTTACATAATTTAAAATAGG - Intergenic
1008287252 6:49668967-49668989 TTTTATACACAGTTGAAAAAAGG + Intergenic
1009268123 6:61581754-61581776 ATGGATATATAGTATTAAAATGG + Intergenic
1009423496 6:63488985-63489007 ATGGATTGCCAGTTTAAAATTGG - Intergenic
1009551155 6:65093460-65093482 ATGTATACACAATATAAAATAGG + Intronic
1009856199 6:69267513-69267535 AAAGATGCAGAGTTTAAAAAGGG + Intronic
1011415440 6:87115000-87115022 ACGGACACAAAGTTTAAAAAGGG - Intergenic
1011837166 6:91446951-91446973 ATGGAAAAGAAGTTTAAAAAAGG + Intergenic
1011956603 6:93031938-93031960 ATATATACACATTTTAAAATTGG - Intergenic
1012119113 6:95341008-95341030 ATGTATCCATATTTTAAAAATGG + Intergenic
1012179638 6:96136582-96136604 ATGGATACATAGTATTCAAAAGG - Intronic
1012720951 6:102743893-102743915 ATGGATAGAGAGTTCATAAAAGG + Intergenic
1013216331 6:108030920-108030942 ATGGATACAAACTTTCTAAAGGG - Intergenic
1013627850 6:111955398-111955420 ATGAATACATACTTTAAGAAGGG + Intergenic
1013783862 6:113757737-113757759 ATGGGTACACAGTTTCAATTTGG - Intergenic
1014165274 6:118217495-118217517 ATGGGTACAGAGTTTTAGAATGG + Intronic
1014850398 6:126333846-126333868 ACAGATACACAGCTTAAAAGGGG - Intergenic
1015050875 6:128837878-128837900 AAGGATACACAGGTTAAACCAGG - Intergenic
1015098755 6:129449711-129449733 TTAGATACTCAGTTTTAAAATGG + Intronic
1016511177 6:144845017-144845039 GTGTAGACACAGTTAAAAAACGG - Intronic
1016923749 6:149319124-149319146 ATTGATTCACATTTTAGAAAAGG + Intronic
1017612407 6:156202850-156202872 ATGGATTCAAAATTTAAAGATGG + Intergenic
1017645530 6:156536664-156536686 AGGGATCCACAATTAAAAAATGG + Intergenic
1018931414 6:168242510-168242532 GTGTATACACATGTTAAAAAGGG + Intergenic
1020592665 7:10161251-10161273 ATGTATACACAGTATAAATTCGG - Intergenic
1021594396 7:22299725-22299747 ATGAAAACAGATTTTAAAAATGG - Intronic
1021730920 7:23594996-23595018 ACAGATACAAAGTTTAAAAAAGG - Intergenic
1021934744 7:25618821-25618843 AAGGACACAAAGTTTATAAAAGG - Intergenic
1022016948 7:26358334-26358356 ATGGATATTTGGTTTAAAAATGG + Intronic
1022519996 7:31000142-31000164 ATAGATACACAGGGAAAAAAAGG + Intergenic
1023271853 7:38471766-38471788 ATAGGTAGAAAGTTTAAAAATGG + Intronic
1023505202 7:40892164-40892186 ATGGATACACAATATATAAAAGG + Intergenic
1024212050 7:47214547-47214569 ATGAATAGATAGTTAAAAAATGG - Intergenic
1024326162 7:48110854-48110876 ATGAATACATAGTTAAAAAGGGG + Intergenic
1024880833 7:54083547-54083569 ATGGATACATTTTTAAAAAAAGG + Intergenic
1024970052 7:55060832-55060854 ATGGTTACACAGTTGGAAACAGG - Intronic
1027584262 7:80037938-80037960 ATGGATACACATTTCAGAAATGG - Intergenic
1027915700 7:84318243-84318265 TTTGAAACACAGTTTAAATAAGG + Intronic
1027995226 7:85417428-85417450 ATAAATACAAATTTTAAAAAAGG + Intergenic
1028078139 7:86540054-86540076 AAGAAGACACAGGTTAAAAATGG + Intergenic
1028103696 7:86852065-86852087 AGGGTCACACACTTTAAAAATGG + Intronic
1028334938 7:89640219-89640241 ATGGAGAAACAGTGGAAAAAGGG - Intergenic
1030547205 7:110911158-110911180 ATACGTACACAGTTAAAAAAAGG + Intronic
1031532369 7:122890305-122890327 ATGGATGCACAGTAATAAAATGG + Intergenic
1031730725 7:125297636-125297658 ATGTATACAAAATTTAATAATGG - Intergenic
1035251336 7:157599433-157599455 CTGAATACACAGTGTAAAGATGG + Intronic
1036055581 8:5249813-5249835 CTGGATCCAGAGATTAAAAAAGG + Intergenic
1037267714 8:17084467-17084489 AGGGGTACAAAGTTGAAAAAGGG - Intronic
1038119560 8:24597438-24597460 AAAGATACACAGTTTAAACTTGG - Intergenic
1038580179 8:28741417-28741439 ATAAATACACTTTTTAAAAAAGG - Intronic
1039513218 8:38108348-38108370 TTGGATAGACAGTTTAGGAAAGG + Intronic
1039593085 8:38767248-38767270 ATGGATACACAGGTGTGAAAAGG - Intronic
1039603356 8:38860703-38860725 ATGTATACATAGATGAAAAATGG + Intergenic
1039635777 8:39163128-39163150 ATATATACACAGTTTAATAATGG + Intronic
1039814341 8:41079617-41079639 ACGAATACACAGCTTCAAAAAGG - Intergenic
1040460810 8:47646142-47646164 ATGAATACACAGTTCATAAAAGG + Intronic
1040570379 8:48603773-48603795 ATAAATACACATTTTACAAAAGG - Intergenic
1040932749 8:52751983-52752005 ACAGATACAAAGCTTAAAAAGGG + Intergenic
1042573169 8:70189437-70189459 AGAGATACACAGATGAAAAATGG - Intronic
1042992042 8:74652367-74652389 ATGAAAACACATTTTTAAAAGGG + Intronic
1043051733 8:75393790-75393812 ATGGCTACACAGTCAAAAGAAGG + Intergenic
1044205489 8:89488280-89488302 ATAGATACACAGTTTTAAATTGG - Intergenic
1044768112 8:95598205-95598227 ATGGTTACACAGGTAATAAATGG - Intergenic
1044894100 8:96870360-96870382 ATTGATATACAGATTAAATACGG + Intronic
1046162287 8:110382609-110382631 ATATATACACATTTCAAAAATGG - Intergenic
1048280811 8:133104321-133104343 ATTGATCCACTGTTTTAAAAAGG + Intronic
1049208381 8:141374027-141374049 ATGCCTACTCATTTTAAAAATGG + Intergenic
1049892961 9:87971-87993 AAGGAGTCACAGTTTTAAAATGG + Intergenic
1051183623 9:14437373-14437395 ATGGCAACACATTTTAAATAGGG + Intergenic
1052186310 9:25600170-25600192 AAGGTTACACAGTTAATAAATGG - Intergenic
1052205654 9:25836484-25836506 TTGTATACACAGTTTAAACCAGG - Intergenic
1053032617 9:34794270-34794292 ATGGAAACACAGTTCACAGAAGG + Intergenic
1053400833 9:37820294-37820316 ATGGACACAAAGTTTTAAACGGG + Intronic
1053644529 9:40112754-40112776 ATGGATAAACAGTTTACAGATGG - Intergenic
1053734182 9:41088034-41088056 AAGGACTCACAGTTTTAAAATGG + Intergenic
1053761453 9:41352097-41352119 ATGGATAAACAGTTTACAGATGG + Intergenic
1054325552 9:63710634-63710656 ATGGATAAGCAGTTTACAGATGG - Intergenic
1054350225 9:64013642-64013664 ATGGATAAACAGTTTACAGATGG + Intergenic
1054540046 9:66263215-66263237 ATGGATAAACAGTTTACAGATGG + Intergenic
1054694215 9:68343518-68343540 AAGGAGTCACAGTTTTAAAATGG - Intronic
1055684352 9:78754389-78754411 TGGGACACACAGTTTAAAAGGGG + Intergenic
1055803827 9:80070487-80070509 AAGGGTAGACAGTGTAAAAATGG + Intergenic
1055836449 9:80448624-80448646 ATGGGTACAGAGTTTTAAAATGG - Intergenic
1055839021 9:80480100-80480122 AGTGATACACAGTTTTAAGAGGG + Intergenic
1055841692 9:80512841-80512863 ATGGGTACACAGTTTAAGTTTGG - Intergenic
1056092097 9:83215566-83215588 ATGGACTCACAGTTTTGAAATGG - Intergenic
1056538692 9:87553008-87553030 ATGGATACACAGTTTCAGCTTGG - Intronic
1058485307 9:105438076-105438098 ATGAATACACAGTTGATAAGGGG + Intronic
1058649609 9:107162825-107162847 ATGGAAACACACTTAAAACAAGG + Intergenic
1059584447 9:115591013-115591035 ATGAATTCCCATTTTAAAAATGG - Intergenic
1059761567 9:117342688-117342710 CTGAAAACACAGTTTGAAAATGG - Intronic
1060347605 9:122830333-122830355 AAAGATACACTGTTTAAAATAGG + Intergenic
1061440031 9:130595550-130595572 ATGGATACGGAGTACAAAAACGG + Exonic
1061566270 9:131442803-131442825 TTGGATGAACAGATTAAAAATGG - Intronic
1203488534 Un_GL000224v1:81811-81833 ATGGATACACAGTTTAAAAAGGG - Intergenic
1203501155 Un_KI270741v1:23707-23729 ATGGATACACAGTTTAAAAAGGG - Intergenic
1186259873 X:7766008-7766030 TTGGATACATAGTTCAAAACTGG + Intergenic
1187307946 X:18114068-18114090 ATGGACAAACATTATAAAAATGG + Intergenic
1187625269 X:21105157-21105179 AGGGGTACACAATTTAAACAAGG + Intergenic
1188073873 X:25751502-25751524 ATATATGCACAATTTAAAAATGG - Intergenic
1188402770 X:29768006-29768028 ATAAATACATAATTTAAAAATGG - Intronic
1188630619 X:32354810-32354832 ATGCTTACACATTTTAAAACTGG + Intronic
1189582425 X:42420864-42420886 GTGGATAAAAAGTTTAAAAATGG + Intergenic
1189648613 X:43163495-43163517 ATAAATACAGATTTTAAAAATGG + Intergenic
1189664147 X:43334717-43334739 CTGGATAAACTGTTTATAAAAGG + Intergenic
1189867768 X:45349260-45349282 ATGGAAACACAGAATCAAAAAGG - Intergenic
1191202505 X:57799153-57799175 ATGGATACAGAGTGGAAAATTGG + Intergenic
1191957309 X:66658162-66658184 ATGGATATAGAGTATAAGAACGG + Intergenic
1193108887 X:77707433-77707455 ATAAATACCCATTTTAAAAATGG + Intronic
1193279637 X:79631211-79631233 ATGGAGACATTGTTTATAAAAGG - Intergenic
1196824326 X:119729143-119729165 ATGAATACACAGTTCAAAGTGGG + Intergenic
1196873396 X:120134394-120134416 ATGTGTACAGACTTTAAAAATGG - Intergenic
1196896181 X:120338795-120338817 AATGATACAAAATTTAAAAATGG + Intergenic
1197042919 X:121961872-121961894 AAGGATACAAAGTTTATAAAAGG + Intergenic
1197383668 X:125777331-125777353 AGTAATACACAGTTCAAAAAAGG + Intergenic
1197646248 X:129020585-129020607 ATATATACACAATTTTAAAAAGG + Intergenic
1197697886 X:129570301-129570323 ATGGTTACACAGTTAGAAAGTGG - Intronic
1197804580 X:130386591-130386613 ATGGATACACATCCTAAAACAGG - Intergenic
1198092104 X:133341822-133341844 AAGGATACACCCTTCAAAAACGG + Intronic
1198329514 X:135608952-135608974 ATGAATGCACAGTGTCAAAAAGG + Intergenic
1198665631 X:139019159-139019181 ATGGATACACAGGTAGAAAGTGG + Intronic
1201151183 Y:11096491-11096513 ATGGATAAACAGTTTACAGATGG + Intergenic
1201456067 Y:14167891-14167913 TTGGATACATAGTTCAAAACTGG - Intergenic
1201722797 Y:17120099-17120121 ATGGATAAACAGTCTCAATAGGG - Intergenic
1201922103 Y:19245025-19245047 ATGAATACATAGTTCAAAAAAGG + Intergenic