ID: 957090386

View in Genome Browser
Species Human (GRCh38)
Location 3:75724098-75724120
Sequence AACAAGGAAGGGCCTCCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957090381_957090386 -8 Left 957090381 3:75724083-75724105 CCACCTCGGCTGCCAAACAAGGA 0: 6
1: 15
2: 29
3: 33
4: 120
Right 957090386 3:75724098-75724120 AACAAGGAAGGGCCTCCAACCGG 0: 1
1: 0
2: 1
3: 13
4: 133
957090378_957090386 -6 Left 957090378 3:75724081-75724103 CCCCACCTCGGCTGCCAAACAAG 0: 1
1: 1
2: 4
3: 9
4: 97
Right 957090386 3:75724098-75724120 AACAAGGAAGGGCCTCCAACCGG 0: 1
1: 0
2: 1
3: 13
4: 133
957090377_957090386 5 Left 957090377 3:75724070-75724092 CCTCTCTCTCTCCCCACCTCGGC 0: 1
1: 1
2: 24
3: 121
4: 1151
Right 957090386 3:75724098-75724120 AACAAGGAAGGGCCTCCAACCGG 0: 1
1: 0
2: 1
3: 13
4: 133
957090379_957090386 -7 Left 957090379 3:75724082-75724104 CCCACCTCGGCTGCCAAACAAGG 0: 1
1: 1
2: 5
3: 9
4: 113
Right 957090386 3:75724098-75724120 AACAAGGAAGGGCCTCCAACCGG 0: 1
1: 0
2: 1
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957090386 Original CRISPR AACAAGGAAGGGCCTCCAAC CGG Intronic
903886716 1:26545146-26545168 AAGAAAGAATGGCATCCAACAGG - Intronic
909604015 1:77490532-77490554 AACAAAGAAGGGATTCCCACAGG + Intronic
910823318 1:91375416-91375438 AACAAGGAAGGGTGTGCAACAGG - Exonic
912502172 1:110129921-110129943 GAGAAGGAAGGGACTCCAAGAGG - Intergenic
914843579 1:151267521-151267543 AACAAGGAAGGTTCTCCTTCAGG - Intergenic
915513048 1:156397224-156397246 AAGAAGGAAGGGCCTGAAAATGG + Intergenic
916411786 1:164553441-164553463 GAGCAGGAAGAGCCTCCAACAGG - Intergenic
916413877 1:164575021-164575043 AACTGGGATTGGCCTCCAACTGG - Intronic
919980184 1:202638017-202638039 TACAAGGAAGGACTTCCTACCGG - Intronic
920551970 1:206869627-206869649 AAAATGGAAGGGCCTCAAAAGGG - Intergenic
921977335 1:221217421-221217443 AACAAGGTGGGGGCACCAACTGG + Intergenic
923861736 1:237898485-237898507 AAGAAGGAATGACCTCCAGCTGG - Intergenic
923927235 1:238645861-238645883 AAAAAGGAAGGGCCTCCAAGAGG + Intergenic
924932026 1:248740341-248740363 AAGAAGGAAGGGCCACCAGGAGG + Intronic
1063822245 10:9849839-9849861 AAAAATTAAGGGCCTCCAGCAGG - Intergenic
1070664457 10:78333362-78333384 GAGAAGGTAGGGCCTCCATCTGG - Intergenic
1070942221 10:80357481-80357503 AACCAGGAAGGGCAGCCAATCGG + Intronic
1071368469 10:84926510-84926532 CACAGTGAAGGGCATCCAACAGG + Intergenic
1073631645 10:105155499-105155521 AACACTGAAAGGCCTCCATCAGG + Intronic
1076055848 10:127372250-127372272 CCCAAGGAGGGGCCTCCAAATGG - Intronic
1082009187 11:47438751-47438773 AGCAAGGTAGGGCCTGCAGCCGG + Exonic
1082820405 11:57541049-57541071 AACCAGGAAGGGGCTCTAGCAGG + Intergenic
1083609359 11:63997838-63997860 AAGCAGGAGGGGCCTCCAAGAGG - Exonic
1084404208 11:68961538-68961560 AAAAAGGAGTGGGCTCCAACTGG - Intergenic
1087291575 11:96326445-96326467 AAGAAGGAAGGGCATGCAATTGG - Intronic
1087533775 11:99416876-99416898 AACAAGGAAGAGCTCCCAAGTGG - Intronic
1097182489 12:57179249-57179271 AAGAAGGCAGGGCCTGAAACCGG + Intronic
1098772558 12:74572614-74572636 AACATGGAAGTGCCCCCAAGAGG + Intergenic
1100607174 12:96161316-96161338 AACAAAGCAGGGCCTCAACCAGG - Intergenic
1101541833 12:105672404-105672426 AACAAGAAATGGCCACCAAAAGG - Intergenic
1103330548 12:120151040-120151062 CACAAGCAACGGCCTCCACCTGG + Intronic
1104855832 12:131902129-131902151 AAGAAGGAAGGGCCACCCTCTGG - Intronic
1105250815 13:18697601-18697623 CAGAAGGAAGGGCGTCCACCAGG - Intergenic
1107177663 13:37418679-37418701 AACAAGGAAGGGACTGAATCAGG - Intergenic
1107934472 13:45333888-45333910 ACCAAGGGAGGGCCTCCCAGAGG - Exonic
1112548604 13:100397036-100397058 AATAAGGAAGGGCCTCTAAATGG - Intronic
1115366590 14:32564395-32564417 AAAAAGGAAGGGCCTGTAATAGG + Intronic
1202890100 14_KI270722v1_random:148576-148598 AACAAGGAAGGTCCCCCGACTGG - Intergenic
1202891101 14_KI270722v1_random:158844-158866 AACAGGGAAGGGCCCCCATCTGG + Intergenic
1124216714 15:27813273-27813295 TAGTGGGAAGGGCCTCCAACTGG + Intronic
1126395836 15:48216298-48216320 GACCAGGAAGGGCATCCATCAGG + Intronic
1126935169 15:53698715-53698737 AACAAGCAAGACCCTCAAACTGG + Intronic
1130648990 15:85751539-85751561 AGCAAGGGAGGGCCCCAAACTGG - Intergenic
1132210693 15:100020135-100020157 AGCAGGGCAGGGCCTCCCACTGG - Intronic
1133028445 16:2998582-2998604 AAGACGGAGGGGCCTCCATCAGG + Intergenic
1133283358 16:4679469-4679491 TACGTGGAAGGGGCTCCAACAGG - Intronic
1137268450 16:46886747-46886769 AACCAGGAAGGGTTTCCAGCAGG + Intronic
1137889975 16:52149250-52149272 ACCAAGATAGGGCCTCCATCTGG + Intergenic
1143348644 17:6270131-6270153 ATCAAGGAAGGGCTTCCTAAAGG - Intergenic
1143402223 17:6653804-6653826 AACATTGAAGGGTTTCCAACAGG + Intergenic
1147139946 17:38455219-38455241 AACAAGGAAGAACTTCCCACAGG + Intronic
1148453613 17:47798107-47798129 AACAGGTAAGGGCCTGGAACAGG - Intergenic
1149262690 17:54897042-54897064 AACAAGGAAGGGCCATCACATGG + Intergenic
1149524511 17:57344360-57344382 CAGAATGAAGGGCCTCCCACTGG - Intronic
1152912782 17:83014796-83014818 AACAGGCAAGGGCCTTGAACAGG + Intronic
1154438034 18:14361325-14361347 CAGAAGGAAGGGCGTCCACCAGG + Intergenic
1156103040 18:33621620-33621642 AACAAGGAAGGGACTGTGACTGG + Intronic
1156879933 18:42064916-42064938 AACAAGGAAGGGGATAAAACTGG - Intronic
1157490051 18:48116774-48116796 AACCAGGAAGGGCCTCCTAGAGG - Intronic
1161673111 19:5625199-5625221 ACCAAGAAAGGGACACCAACAGG - Intronic
1162145056 19:8608489-8608511 AACCAGGAAGGGCCTTGATCTGG - Intronic
1162252378 19:9456500-9456522 AACAAGGGAGAGCCACCTACTGG + Intergenic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162529704 19:11228880-11228902 AAAAAGGAAGGGGCTCCACTGGG + Intronic
1163625975 19:18389903-18389925 AACATGGAAGTGCCACAAACAGG - Intergenic
1163644469 19:18480567-18480589 AGCAGGAAAGGGACTCCAACTGG + Intronic
1163812793 19:19444446-19444468 AACAACGATAGGCCTCCTACTGG - Intronic
1202665517 1_KI270708v1_random:115408-115430 AACAAGGAAGGTCCCCCGACTGG - Intergenic
1202666520 1_KI270708v1_random:125682-125704 AACAGGGAAGGGCCCCCGTCTGG + Intergenic
925896429 2:8475663-8475685 AACAAGGAAGAGCATCAACCAGG + Intergenic
927190823 2:20515792-20515814 AAACAGGAAAGGCCTCCATCTGG - Intergenic
927316079 2:21684783-21684805 AACAAGAAAGGCTCTGCAACAGG - Intergenic
930967042 2:57341866-57341888 AAAAATGAAGGGCATCCAAATGG - Intergenic
931821539 2:65957032-65957054 GACAAGTAAGGGCCACCACCAGG + Intergenic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
934477361 2:94602468-94602490 TACAAGGGAGGGCCTCTAAGGGG - Intronic
936075225 2:109397532-109397554 AAGAAGGAAGGGGCTCCATTGGG + Intronic
936249104 2:110853721-110853743 AACAAGAAAGGGCCTCGGGCTGG - Intronic
936894980 2:117417226-117417248 ATCAAGGCAGTGCCTCCCACAGG - Intergenic
937842213 2:126535322-126535344 CCCAAGGAAAGGCCTCCCACAGG + Intergenic
941876394 2:170437911-170437933 AACAAGAAAAAGTCTCCAACTGG - Intronic
942689621 2:178571691-178571713 GACAAACCAGGGCCTCCAACTGG - Exonic
944447933 2:199810483-199810505 AAGAAAGAGGTGCCTCCAACAGG - Intronic
946693823 2:222332670-222332692 ACCAAGGAGGGGCCTCAAAATGG + Intergenic
947742551 2:232491219-232491241 CACAAGGCAGGGCCTCCTCCTGG + Intergenic
947897230 2:233686904-233686926 AACAAGAAAGGGCATCCCACTGG + Intronic
1175319469 20:58075085-58075107 AACAAGGAGTGGCCCCCAAAGGG + Intergenic
1178690493 21:34746086-34746108 ATCAAGGAAGTGCCTGCAAGTGG - Intergenic
1180022513 21:45137439-45137461 ACCAAGGAAGGGCAGCCAAGGGG - Intronic
1180332232 22:11492328-11492350 AACAAGGAAGGTCCCCCGACTGG - Intergenic
953423944 3:42777358-42777380 AATAAAGAAGGGACTCAAACAGG + Intronic
953955503 3:47228666-47228688 AACCATGATGGGCCTCCAGCAGG - Exonic
955027778 3:55187143-55187165 CCCAAGGCAGGGCCACCAACGGG - Intergenic
957090386 3:75724098-75724120 AACAAGGAAGGGCCTCCAACCGG + Intronic
958980178 3:100710222-100710244 AACCAGGCTGGGCCTCCAGCCGG - Intronic
959975692 3:112456250-112456272 AACATGGAAGGGCATCAATCTGG - Intergenic
964641675 3:158915451-158915473 CACAAGAAAGGGCTTGCAACGGG + Intergenic
966407133 3:179609582-179609604 AACAAGGAAGGGGCCCCAGGTGG - Intronic
969241689 4:5902925-5902947 ATGCAGGAAGGGCCTGCAACTGG - Intronic
975491223 4:74990803-74990825 AACACTGGAGGGCCTCCAACTGG - Intronic
988110494 5:26813154-26813176 CACCAGGCAGGGCCTCCCACAGG + Intergenic
988137015 5:27186942-27186964 AACAAGGACTGCCCTTCAACTGG + Intergenic
988529096 5:32011639-32011661 AAGGAGGAAGGGGCTCCAAGGGG - Intronic
989613652 5:43318496-43318518 TACAAAGAAATGCCTCCAACAGG - Intergenic
992082376 5:73247182-73247204 AACAAGGCAGGGCTTTCACCAGG + Intergenic
1001890482 5:175334033-175334055 AGCCAGGAAGGACCTCCAAGAGG + Intergenic
1002668816 5:180848342-180848364 GAAAACTAAGGGCCTCCAACAGG - Exonic
1007940461 6:45775892-45775914 AACAAGAAAGGGCCTGCTCCTGG - Intergenic
1014216215 6:118754913-118754935 AAGAAGGGAGGGTCTGCAACGGG - Intergenic
1014421992 6:121257799-121257821 AACCAGAAGGGGCCTCCTACTGG - Intronic
1018557334 6:165062996-165063018 AGGAAGAAAAGGCCTCCAACCGG - Intergenic
1019920387 7:4159442-4159464 AACCTGCAAGAGCCTCCAACAGG + Intronic
1022135073 7:27439451-27439473 AAAGAGGAAGGGACTCCATCGGG - Intergenic
1022213507 7:28235341-28235363 AACAATGAAGGGCCTGCTACTGG + Intergenic
1023291786 7:38675764-38675786 AACAAGGCAGAGCTTCCAACAGG - Intergenic
1025337952 7:58432900-58432922 TCCAACGAAGGGCCTCAAACAGG - Intergenic
1025383463 7:59239723-59239745 TCCAACGAAGGGCCTCAAACAGG - Intergenic
1025395442 7:59452617-59452639 TCCAACGAAGGGCCTCAAACAGG - Intergenic
1025416364 7:59823125-59823147 TCCAACGAAGGGCCTCAAACAGG - Intergenic
1026581251 7:71619762-71619784 AAAAAGAAAAGGCATCCAACAGG - Intronic
1029941450 7:104484701-104484723 AAGATGGAAGGGCCTGCACCTGG + Intronic
1030537559 7:110788272-110788294 AACAAGGAAGTACCTCCTAAGGG + Intronic
1033809706 7:144997681-144997703 AGAAAGAAAGGGCATCCAACTGG - Intergenic
1034076380 7:148235594-148235616 CACAAGGAAGAGCCTCCCAGAGG - Intronic
1035642422 8:1194188-1194210 AACAAGGCGTGGCCTCCCACAGG - Intergenic
1039428816 8:37509773-37509795 ATCAAGGAAGTGTCTCCAAAGGG - Intergenic
1044446336 8:92281180-92281202 AACATTGATGGGCCACCAACAGG + Intergenic
1047097564 8:121640804-121640826 AAGGATGAAGGTCCTCCAACAGG - Intronic
1048840208 8:138558950-138558972 AACAAGGCCATGCCTCCAACAGG + Intergenic
1048867254 8:138770147-138770169 AGCAAGGAGGGGCCTCAAAATGG - Intronic
1049557279 8:143289393-143289415 ACCCAGGAGGGGCCTCCAGCAGG - Intergenic
1051431057 9:16980902-16980924 ACAAGGGAAGGGCCTCCAGCTGG + Intergenic
1052852609 9:33387094-33387116 TACAAGGGAGGGCCTCTAAGGGG + Intronic
1053680709 9:40483645-40483667 TACAAGGGAGGGCCTCTAAGGGG + Intergenic
1053930694 9:43111957-43111979 TACAAGGGAGGGCCTCTAAGGGG + Intergenic
1054283004 9:63141290-63141312 TACAAGGGAGGGCCTCTAAGGGG - Intergenic
1054293791 9:63319160-63319182 TACAAGGGAGGGCCTCTAAGGGG + Intergenic
1054391815 9:64623649-64623671 TACAAGGGAGGGCCTCTAAGGGG + Intergenic
1054503912 9:65892679-65892701 TACAAGGGAGGGCCTCTAAGGGG - Intronic
1058508531 9:105691466-105691488 AACTAAAAAGTGCCTCCAACAGG + Intergenic
1058961635 9:109997768-109997790 ACCAAGGAAGAGCCACCACCTGG + Intronic
1059476635 9:114552742-114552764 AAAGAGGAAAGGCCTCCACCTGG + Intergenic
1061561408 9:131406252-131406274 AACTAGCAAGGGCCTCCCATGGG + Intronic
1203487192 Un_GL000224v1:67743-67765 AACAAGGAAGGTCCCCCGACTGG - Intergenic
1203499813 Un_KI270741v1:9643-9665 AACAAGGAAGGTCCCCCGACTGG - Intergenic
1194558056 X:95387005-95387027 AATAATGAAGGGCATCCAAATGG - Intergenic
1198033351 X:132777070-132777092 AACTAGGAAGGGGGTACAACTGG + Intronic
1201955128 Y:19614796-19614818 AACAAAAAGGGGCCTGCAACTGG - Intergenic