ID: 957091274

View in Genome Browser
Species Human (GRCh38)
Location 3:75732514-75732536
Sequence TGCACTAATCCCAATCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 3, 2: 3, 3: 75, 4: 776}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957091274_957091276 -10 Left 957091274 3:75732514-75732536 CCAACCTGATTGGGATTAGTGCA 0: 1
1: 3
2: 3
3: 75
4: 776
Right 957091276 3:75732527-75732549 GATTAGTGCACTTATGAAACAGG 0: 1
1: 8
2: 73
3: 498
4: 1140
957091274_957091278 27 Left 957091274 3:75732514-75732536 CCAACCTGATTGGGATTAGTGCA 0: 1
1: 3
2: 3
3: 75
4: 776
Right 957091278 3:75732564-75732586 TTTGTCCATTTCAACATGAGAGG 0: 1
1: 5
2: 0
3: 19
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957091274 Original CRISPR TGCACTAATCCCAATCAGGT TGG (reversed) Intronic
900874181 1:5329851-5329873 GGCACTAATCCCATTCACGAGGG + Intergenic
901941227 1:12663457-12663479 GGCACTAATCCCATTCATGAGGG + Intronic
902611262 1:17598569-17598591 GGCACTAATCCCAACCATGGGGG + Intronic
902652897 1:17848228-17848250 GGCACTAATCCCATTCATGAGGG + Intergenic
903558866 1:24212791-24212813 GGCACTAATCCCATTCATGAGGG - Intergenic
903794256 1:25916736-25916758 GGCACTAATCCCATTCATGAGGG + Intergenic
904868165 1:33599004-33599026 GGCACTAATCCCATTCATGAGGG + Intronic
905017669 1:34788635-34788657 GGCACTAATCCCATTCAGGAGGG - Intronic
905235992 1:36548672-36548694 GGCACTAATCCCACTCACGAGGG - Intergenic
905426881 1:37892839-37892861 GGCACTAATCCCAATCATGAGGG - Intronic
905994154 1:42366448-42366470 GGCACTAATCCCAATCGTGAGGG - Intergenic
906651848 1:47518325-47518347 GGCACTAATCCCATTCATGAGGG - Intergenic
906717060 1:47978147-47978169 TGCACTAATACTATTCATGTGGG - Intronic
906766434 1:48438866-48438888 TGCCCAAAGCCCCATCAGGTGGG + Intronic
906830059 1:49021464-49021486 GGCACTAATCCCATTCATGAGGG - Intronic
907201336 1:52729206-52729228 GGCACTAATCCCATTCATGTGGG + Intronic
907557971 1:55361359-55361381 GACACTAATCCCAATCATGAAGG - Intergenic
907617044 1:55936197-55936219 GGCACTAATCCCATTCATGAGGG + Intergenic
907869437 1:58430037-58430059 GGCACTAATCCCATTCAAGAGGG + Intronic
908584809 1:65556084-65556106 GGCACTAATCCCATTCATGAGGG - Intronic
908734062 1:67257396-67257418 TTCACTAATCCCATTCATGAAGG + Intronic
908810250 1:67974962-67974984 GGCACTAATCCCATTCATGAAGG + Intergenic
908900529 1:68951273-68951295 GGCACTAATCCCATTCATGAGGG - Intergenic
908949740 1:69545750-69545772 GGCACTAATCCCATTCATGAGGG + Intergenic
909273993 1:73661308-73661330 AGCACTAATTCCAATCATGAGGG + Intergenic
909366415 1:74828541-74828563 GGCACTAATCCCATTCATGAGGG + Intergenic
909973145 1:82014873-82014895 TGCTCTAATATCACTCAGGTTGG + Intergenic
911377544 1:97069578-97069600 GGCACTAATCCCATTCACGAGGG + Intergenic
911885443 1:103291811-103291833 GGCACTAATCCCATTCACGAGGG + Intergenic
912162644 1:107004742-107004764 TGCACTCTTCCCAATCTGATAGG + Intergenic
912269716 1:108196777-108196799 AGCACTAATCCCATTCATGAAGG + Intronic
912855009 1:113160055-113160077 GGCACTAATCCCATTCATGGGGG - Intergenic
914077501 1:144369122-144369144 GGCACTAATCCCATTCATGAGGG + Intergenic
914101678 1:144597383-144597405 GGCACTAATCCCATTCATGAGGG - Intergenic
914172408 1:145237662-145237684 GGCACTAATCCCATTCATGAGGG + Intergenic
914297286 1:146340128-146340150 GGCACTAATCCCATTCATGAGGG + Intergenic
914639345 1:149588470-149588492 GGCACTAATCCCATTCATGAGGG - Intergenic
915012780 1:152704638-152704660 GGCACTAATCCCATTCATGAAGG + Intergenic
915718668 1:157967414-157967436 GGCACTAATCCCATTCATGAGGG - Intergenic
916142850 1:161714149-161714171 GGCACTAATCCTAATCATGAGGG - Exonic
916396734 1:164398502-164398524 AACACTAATCCCAATCATGAGGG - Intergenic
916406886 1:164506711-164506733 GGCACTAATCCCACTCATGAGGG - Intergenic
916821585 1:168404003-168404025 GGCACTAATCCCATTCATGGGGG + Intergenic
917159897 1:172045467-172045489 GGCACTAATCCCATTCATGAGGG + Intronic
917481211 1:175413808-175413830 GGCACTAATCCCATTCATGAGGG - Intronic
917685942 1:177416214-177416236 GGCACTACTCCCATTCAGGAGGG - Intergenic
917724558 1:177816359-177816381 GGCACTAATCCCATTCATGAGGG - Intergenic
917851219 1:179065976-179065998 GGCACTAATCCCGTTCATGTGGG + Intronic
917908437 1:179613698-179613720 GGCACTAATCCCATTCATGGGGG + Intronic
918041957 1:180919029-180919051 GGCACTAATCCCATTCATGAGGG + Intronic
918631200 1:186720462-186720484 GGCATTAATCCCAATCATGAGGG - Intergenic
918798173 1:188933095-188933117 GGCACTAATCCCATTCATGAGGG + Intergenic
919481359 1:198093886-198093908 GGCACTAATCCCATTCATGAAGG + Intergenic
919540798 1:198843019-198843041 ATCACCAATCCCAATCTGGTTGG - Intergenic
919569133 1:199223814-199223836 GGCACTAATCCCATTCATGAGGG + Intergenic
919630650 1:199957181-199957203 GGCACTAATCCCATTCATGAGGG - Intergenic
920253770 1:204640279-204640301 GACATTAATCCCACTCAGGTGGG + Intronic
920582572 1:207125520-207125542 GGCACTAATCCCATTCATGAGGG - Intronic
920867090 1:209762279-209762301 GGCACTAATCCCATTCATGAGGG + Intronic
920933996 1:210414229-210414251 AGCACTAATCCTAATCATGAAGG + Intronic
921033131 1:211351348-211351370 GGCACTAATCCCATTCATGAGGG + Intronic
921681791 1:218042175-218042197 GGCACTAATCCCATTCACGAGGG - Intergenic
921826819 1:219681368-219681390 AGCACTACTCCCATTCATGTGGG + Intergenic
922025976 1:221749275-221749297 AGCACTAATCCCATTCATGAGGG + Intergenic
922348574 1:224717357-224717379 GGCACTAATCCCATTCATGAGGG + Intronic
922423908 1:225476775-225476797 AGCACTAATCCCATTCATGTGGG - Intergenic
923003144 1:230024073-230024095 GGCACTAATCCCACTCATGAGGG + Intergenic
923767015 1:236901752-236901774 GGCACTAATCCCATTCATGAGGG + Exonic
924163355 1:241256737-241256759 GGCACTAATCCCAACCAGGAGGG + Intronic
924209334 1:241748541-241748563 GGCACTAATCCCATTCATGAGGG + Intronic
924721652 1:246628669-246628691 GGCACTAATCCCATTCATGAGGG + Intronic
1063345027 10:5303696-5303718 GGCACTAATCCCATTCATGAGGG - Intergenic
1063728881 10:8672552-8672574 GGCACTAATCCCATTCATGAGGG + Intergenic
1063892630 10:10646005-10646027 TGCACTAATCCTAATCTTTTGGG + Intergenic
1064352205 10:14586518-14586540 GGCACTAATCCCATTCATGAGGG - Intronic
1064541206 10:16406792-16406814 GGCACTAATCCCATTCATGAAGG - Intergenic
1064742120 10:18444201-18444223 GGCACTAATCCCATTCATGAGGG - Intronic
1064829874 10:19450904-19450926 GGCACTAATCCCATTCATGAGGG + Intronic
1064856471 10:19773813-19773835 GGCACTAATCCCATTCATGAGGG + Intronic
1065350940 10:24795168-24795190 GGCACTAATCCCAATCATGAAGG - Intergenic
1066533675 10:36366935-36366957 GGCACTAATCCCATTCATGAAGG - Intergenic
1068927799 10:62558122-62558144 TGCACTAATCCCATACATGAGGG - Intronic
1069376183 10:67795272-67795294 AGCACTAATCCCATTCATGAGGG + Intergenic
1069730264 10:70606957-70606979 GGCACTAATCCCATTCATGAAGG - Intergenic
1069730710 10:70610246-70610268 GGCACTAATCCCACTCATGAGGG - Intergenic
1069747562 10:70725616-70725638 GACACTAATCCCATTCAGGAGGG + Intronic
1070387244 10:75936756-75936778 GGCACTAATCCCATTCAGGGGGG + Intronic
1070944116 10:80374631-80374653 GGCACTAATCCCATTCATGAGGG + Intergenic
1071379553 10:85044562-85044584 GGCACTAATCCCAATTATGAGGG + Intergenic
1071966932 10:90860777-90860799 GGTACTAATCCCATTCAGGAGGG + Intergenic
1072528337 10:96294805-96294827 GGCACTAATCCCGTTCAGGAGGG - Intergenic
1072716387 10:97755553-97755575 GGCACTAATCCCATTCACGAGGG + Intronic
1072991919 10:100204062-100204084 AGCATTAATCCCAAACAGGAAGG + Intronic
1073115040 10:101087198-101087220 TGCACTGCTCCCAATAAGGAAGG + Intergenic
1073640731 10:105250171-105250193 GGCACTAATCCCATTCATGAGGG + Intronic
1074378441 10:112958221-112958243 TGCAGTAGCCCCAACCAGGTCGG + Intronic
1074431965 10:113401875-113401897 GGCACTAATCCCATTCATCTGGG + Intergenic
1074614078 10:115048840-115048862 GGCACTAATCCCATTCATGAGGG - Intergenic
1074654550 10:115570282-115570304 AGCACTAATTCCAATCATGAGGG + Intronic
1075113257 10:119604989-119605011 AGCACTAATCCCATTCATGAAGG - Intergenic
1075196392 10:120362954-120362976 GGCACTAATCCCATTCACGAGGG - Intergenic
1075264116 10:120986370-120986392 AGCACTAATCCCATTCATGAGGG - Intergenic
1075272763 10:121067711-121067733 GGCACTAATCCCATTCATGAGGG + Intergenic
1075580725 10:123616145-123616167 GGCACTAATCCCACTCATGAGGG - Intergenic
1076130965 10:128013646-128013668 GGCACTAATCCCATTCAAGAGGG - Intronic
1076316477 10:129545291-129545313 TGACCAAATCCCAATCAGGATGG - Intronic
1077993587 11:7433638-7433660 GGCACTAATCCCATTCATGAAGG - Intronic
1078443188 11:11384603-11384625 TGCACTAATCCCATTTATGAGGG - Intronic
1078772700 11:14365502-14365524 GGCACTAATCCCATTCATGGGGG - Intergenic
1078972544 11:16430522-16430544 AGCACTAATCCCATTCAAGAGGG - Intronic
1080062857 11:27975362-27975384 GGCACTAATCCCATTCATGAGGG - Intergenic
1080260533 11:30344985-30345007 GGCACTAATCCCATTCATGAAGG + Intergenic
1080294100 11:30705330-30705352 AGCACTAATCCCAGTCAAGAGGG + Intergenic
1080406123 11:31980920-31980942 GGCACTAATCCCACTCAAGAGGG + Intronic
1080412100 11:32035366-32035388 GGCACTAATCCCATTCATGAGGG + Intronic
1080823937 11:35832246-35832268 GGCACTAATCCCATTCATGAGGG - Intergenic
1080878062 11:36294720-36294742 GGCACTAATCCCATTCATGAGGG + Intergenic
1081171059 11:39870619-39870641 TGTACTATTCCCAATCATGAAGG - Intergenic
1081418259 11:42841252-42841274 GGCACTAATCCCATTCATGAGGG - Intergenic
1081598934 11:44478707-44478729 GGCACTAATCTCATTCACGTGGG - Intergenic
1082095550 11:48126638-48126660 GGCACTAATACCATTCAGGAGGG + Intronic
1082205568 11:49429976-49429998 TTCACTAATCCCCATCAGTTAGG + Intergenic
1083541962 11:63517721-63517743 GGCACTAATCCCATTCATGAAGG - Intergenic
1084080923 11:66824213-66824235 GGCACTAATCCCATTCATGAAGG - Intronic
1084654962 11:70509749-70509771 GGCACTAATCCCATTCACGAAGG - Intronic
1084788120 11:71455573-71455595 AGCACTAATCCCATTCATGCAGG - Intronic
1086937510 11:92761307-92761329 GGCACTAATCCCATTCATGAGGG + Intronic
1086975344 11:93125949-93125971 GGCACTAATCCCATTCATGAGGG + Intergenic
1087500814 11:98951407-98951429 GGCACTAATCCCACTCATGAGGG + Intergenic
1087629834 11:100637029-100637051 GGCACTAATCCCATTCATGAAGG - Intergenic
1087687715 11:101284196-101284218 CGCACTAATCCCATTCATGAGGG - Intergenic
1087840682 11:102917863-102917885 GGCACTAACCCCAATCATGAGGG - Intergenic
1088353069 11:108911486-108911508 GGCACTAATCTCATTCAGATAGG + Intronic
1088427748 11:109723497-109723519 GGCACTAATCCCATTCATGAAGG + Intergenic
1089287134 11:117414864-117414886 GGCACTAATCCCAGTCATGAGGG + Intergenic
1089658786 11:119972132-119972154 GGCACTAATCCCATTCAGGAGGG - Intergenic
1090302948 11:125662333-125662355 GGCACTAATTCCATTCAGGAAGG + Intronic
1090865969 11:130700818-130700840 AGCACTAATCCCATTCATGAGGG - Intronic
1090985360 11:131761484-131761506 GGCACTAATTCCAATCACGCAGG - Intronic
1092311122 12:7354810-7354832 GGCACTAATCCCATTCATGAGGG + Intronic
1092696343 12:11175816-11175838 GGCACTAATCCCATTCACGAGGG - Intergenic
1092932724 12:13332105-13332127 GGCACTAATCCCATTCATGAAGG + Intergenic
1093241948 12:16687479-16687501 GGTACTAATCCCATTCAGGAGGG + Intergenic
1094208631 12:27867040-27867062 TGCACTTGTTCCAATCAGCTTGG + Intergenic
1094381348 12:29846803-29846825 CCCACTGATCCCAATCAGGCAGG - Intergenic
1094628565 12:32149844-32149866 GGCACTAATCCCATTCATGAAGG + Intronic
1095474302 12:42570074-42570096 TGCACTATTCCAATTCAGATTGG - Intronic
1095563408 12:43592056-43592078 GGCACTAATCCCATTCATGAGGG + Intergenic
1095903095 12:47348768-47348790 GGCACTAATCCCACTCATGAGGG - Intergenic
1096055360 12:48646255-48646277 GGCACTAATCCCATTCATGAAGG - Intergenic
1096219830 12:49822070-49822092 AGCACTAATCCCATTCATGAGGG - Intronic
1097703105 12:62840298-62840320 AGCACTAATCCCATTCATGAGGG + Intronic
1097724781 12:63063051-63063073 GGCACTAATCCCATTCATGAGGG + Intergenic
1098136879 12:67412522-67412544 GGCACTAATCCCAATCATGAGGG + Intergenic
1098228819 12:68352049-68352071 TGCACTAATCCCACTCATAAAGG - Intergenic
1098300440 12:69048586-69048608 GGCACTAATCCCATTCATGAGGG + Intergenic
1100062625 12:90600057-90600079 GGCACTAATCCCACTCATGAGGG - Intergenic
1101412029 12:104477566-104477588 GGCACTAATCCCATTCATGAGGG - Intronic
1101762796 12:107672856-107672878 GGCACTAATCTCATTCATGTGGG - Intergenic
1101774582 12:107781959-107781981 GGCACTAATCCCACTCATGAGGG - Intergenic
1102396115 12:112587519-112587541 AGCACAAAACCCTATCAGGTAGG - Intronic
1102414315 12:112747256-112747278 AGCACTAATCCCACTCATGAGGG - Intronic
1103093314 12:118113057-118113079 GGCACTAATCCCATTCATGAGGG - Intronic
1103222134 12:119254781-119254803 GGCACTAATCCCATTCATGAAGG + Intergenic
1103897749 12:124285153-124285175 GGCACTAATCCCATTCATGGGGG + Intronic
1104119960 12:125789613-125789635 GGCACTAATCCCATTAATGTGGG - Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105716845 13:23074950-23074972 GGCACTAATCCCATTCATGAGGG + Intergenic
1105832627 13:24177763-24177785 GGCTCTAATCCCATTCAGGAGGG + Intronic
1106127685 13:26913682-26913704 GGCACTAATCCCAAGCATGCGGG - Intergenic
1106362484 13:29045383-29045405 AGCACTAATCCCATTCATGAGGG + Intronic
1106392677 13:29350855-29350877 AGCACTAATCCCATTCATGAGGG + Intronic
1106761247 13:32869974-32869996 GGCACTACTCCCATTCATGTGGG - Intergenic
1107095162 13:36527891-36527913 GGCACTAATCCCATTCATGAGGG + Intergenic
1107455411 13:40550229-40550251 GGCACTAATCCCATTCATGAGGG + Intergenic
1107555367 13:41513103-41513125 GGCACTAATCCCATTCATGAGGG + Intergenic
1107930354 13:45301957-45301979 GGCACTAATCCCATTCATGAGGG + Intergenic
1108531692 13:51332674-51332696 GGCACTAATCCCATTCATGAGGG - Intergenic
1109278628 13:60330287-60330309 GGCACTAATCCCACTCATGAGGG + Intergenic
1110272285 13:73604376-73604398 GGCACTAATCCCATTCGGGAGGG + Intergenic
1110666746 13:78125895-78125917 AGCACTAATCCCATTCATGAGGG + Intergenic
1110844234 13:80175684-80175706 GGCACTAATCCCATTCATGAGGG + Intergenic
1110925330 13:81143506-81143528 TGCACTAATCCCACTCATGAAGG + Intergenic
1111014941 13:82367732-82367754 TGCACTAATCACATTCATGAGGG + Intergenic
1111151324 13:84257041-84257063 GGCACTAATCCCATTCATGAGGG + Intergenic
1111473321 13:88715083-88715105 GGCACTAATCCCATTCATGAGGG - Intergenic
1111527402 13:89491005-89491027 AGCACTAATCCCATTCATGAAGG + Intergenic
1112169909 13:96960533-96960555 GGCACTAATCCCATTCAAGAGGG - Intergenic
1112217193 13:97445061-97445083 GGCACTAATCCCATTCATGAGGG + Intronic
1112996158 13:105577433-105577455 TGCAGTAATCCCATTCATGAGGG + Intergenic
1113395719 13:109945681-109945703 AGCACTAATCCCATTCATGCGGG + Intergenic
1114168451 14:20246380-20246402 GGCACTAATCCCATTCAGGAGGG - Intergenic
1115063140 14:29219159-29219181 TTCACGAATCCCCATCAGTTTGG + Intergenic
1115106655 14:29769994-29770016 GGCACTAATCCCATTCATGAGGG - Intronic
1115649438 14:35392311-35392333 GGAACTAATCCCATTCAGGAGGG - Intergenic
1116438042 14:44915884-44915906 GGCACTAATCCCATCCAGGAGGG - Intergenic
1116786045 14:49289790-49289812 GGCACTAATCCCATTCATGAAGG - Intergenic
1117224371 14:53639453-53639475 GGCACTAATCCCATTCACGAGGG - Intergenic
1117780284 14:59224839-59224861 TACACTAATCCCATTCATGAGGG - Intronic
1118053332 14:62052707-62052729 GGCACTAATCCCACTCATGAGGG - Intronic
1118148044 14:63162048-63162070 GGCACTAATCCCATTCATGAGGG - Intergenic
1118253023 14:64181311-64181333 TGCTCTAAGCCTAATGAGGTAGG - Intronic
1119140578 14:72263613-72263635 GGCACTAATCCCAATCATGAGGG - Intronic
1119680097 14:76585663-76585685 GGCACTAATCCCACTCATGAGGG + Intergenic
1119866353 14:77978382-77978404 GGCACTAATCCCATTCATGAAGG + Intergenic
1119894724 14:78210324-78210346 GGCACTAATCCCATTCATGAAGG + Intergenic
1120292344 14:82590923-82590945 GGCCCTAATCCCAATCATGAAGG - Intergenic
1120353311 14:83393108-83393130 GGCACTAATTCCAATCATGAGGG + Intergenic
1120415913 14:84217581-84217603 GGCACTAATCCCATTCATGAAGG - Intergenic
1120710815 14:87791168-87791190 AGCACTAATCTCATTCAGGAGGG - Intergenic
1120764265 14:88314235-88314257 TGCACTAATCCTAATCATGAAGG - Intronic
1121144279 14:91570179-91570201 AGCACTAATCCCATTCTGGAGGG + Intergenic
1121264186 14:92588547-92588569 GGCACTAATCCCATTCATGAGGG + Intronic
1121356072 14:93216147-93216169 GGCACTAATCCCATTCACGAGGG - Intronic
1121835087 14:97085111-97085133 GGCACTAATCCCATTCATGAGGG + Intergenic
1121946129 14:98124219-98124241 GGCACTAATCCCATTCATGAGGG - Intergenic
1122438518 14:101714592-101714614 GGCACTAATCCCATTCATGAGGG + Intergenic
1202889267 14_KI270722v1_random:140450-140472 TGCACTAATCCCAATCAGGATGG + Intergenic
1123670740 15:22654357-22654379 TGCACTAATCCCATTCATGAGGG - Intergenic
1124060885 15:26292833-26292855 GGCACTAATCCCATTCATGAGGG - Intergenic
1124465912 15:29939732-29939754 GGCACTAATCCCATTCATGAGGG - Intronic
1124526713 15:30460782-30460804 TGCACTAATCCCATTCATGAGGG - Intergenic
1124771940 15:32546901-32546923 TGCACTAATCCCATTCATGAGGG + Intergenic
1124889134 15:33715822-33715844 GGTACTAATCCCACTCATGTGGG + Intronic
1125395498 15:39243213-39243235 AGCACTAATTCCAATCATGAGGG + Intergenic
1125408800 15:39383371-39383393 GGCACTAATCCCATTCATGAGGG + Intergenic
1126360690 15:47842745-47842767 AGCACTAACCCCAATCATGAGGG - Intergenic
1126573893 15:50179657-50179679 GGCACTAATCCCATTCATGAGGG - Intronic
1127174573 15:56339769-56339791 GGCACTAATCCCATTCATGAAGG - Intronic
1129921937 15:79326767-79326789 AGCACTAATCTCATTCAGGAGGG - Intronic
1130163187 15:81423148-81423170 AGCACTAATCCCACTCATGGGGG - Intergenic
1130554629 15:84914256-84914278 GGCACTAATCCCATTCATGAGGG + Intronic
1130559622 15:84947726-84947748 GACACTAATCCCATTCATGTGGG + Intergenic
1131372372 15:91893534-91893556 GGCACTAATCCCATTCATGAGGG + Intronic
1131454043 15:92569540-92569562 GGCACTAATCCCATTCATGAGGG - Intergenic
1131954552 15:97718480-97718502 TGCACTCCTGCCAATCAGGCTGG + Intergenic
1133094327 16:3431061-3431083 GACACTAATCCCAATCATGAGGG + Intronic
1133364183 16:5197957-5197979 TGCACTAATCCCATTCATGAGGG + Intergenic
1133549518 16:6840567-6840589 GGCACTAATCCCATTCATGAGGG - Intronic
1133760023 16:8791164-8791186 GGCACTAATCCCATTCATGAGGG - Intronic
1134186881 16:12091462-12091484 GGCACTAATCCCACTCATGAGGG - Intronic
1134503939 16:14790449-14790471 GGCACTAATCCCATTCATGAAGG - Intronic
1134506120 16:14808606-14808628 TCCACTTAACCCAATGAGGTAGG + Intronic
1134557475 16:15177891-15177913 GGCACTAATCCCATTCATGAGGG + Intergenic
1134574430 16:15320164-15320186 TCCACTTAACCCAATGAGGTAGG - Intergenic
1134576633 16:15338459-15338481 GGCACTAATCCCATTCATGAAGG + Intergenic
1134725806 16:16418040-16418062 GGCACTAATCCCATTCATGAAGG - Intergenic
1134727985 16:16436139-16436161 TCCACTTAACCCAATGAGGTAGG + Intergenic
1134782728 16:16913313-16913335 AGCACTAATCCCACTCATGAGGG - Intergenic
1134903495 16:17959668-17959690 GGCACTAATCCCATTCATGAGGG + Intergenic
1134918044 16:18089570-18089592 GGCACTAATCCCATTCATGAGGG + Intergenic
1134939451 16:18275687-18275709 TCCACTTAACCCAATGAGGTAGG - Intergenic
1134941627 16:18293819-18293841 GGCACTAATCCCATTCATGAAGG + Intergenic
1135012991 16:18900713-18900735 TGCACTAAAGCCAATGAAGTAGG + Intronic
1135060089 16:19264015-19264037 GGCACTAATCCCAATTATGAGGG - Intronic
1135097624 16:19577732-19577754 GGCACTAATCCCATTCATGAGGG - Intronic
1135281391 16:21156539-21156561 GGCACTAATCCCATTTAGGAGGG + Intronic
1135319912 16:21488285-21488307 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135352891 16:21744695-21744717 GGCACTAATCCCACTCATGAGGG + Intronic
1135372748 16:21919772-21919794 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1135439034 16:22450929-22450951 TGCACTAAAGCCAATGAAGTAGG - Intergenic
1135451377 16:22560818-22560840 GGCACTAATCCCACTCATGAGGG + Intergenic
1135804409 16:25529079-25529101 GGCACTAATCCTACTCATGTTGG + Intergenic
1135837377 16:25838835-25838857 TTCACTAATCCCGATGAGATGGG + Intronic
1136330143 16:29569997-29570019 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1136444768 16:30309702-30309724 TGCACTAAAGCCAATGAAGTAGG + Intergenic
1137814929 16:51389503-51389525 GGCACTAATTCCATTCATGTGGG + Intergenic
1138694358 16:58797914-58797936 GGCACTAATCCCATTCATGAGGG + Intergenic
1139154760 16:64427241-64427263 GGCACTAATCCCAATTATGAGGG + Intergenic
1139194652 16:64905123-64905145 GGCACTAATCCTATTCAGGAGGG - Intergenic
1139243535 16:65418809-65418831 GGCACTAATCTCATTCAAGTGGG + Intergenic
1139350504 16:66332063-66332085 GGCACTAATCCCATTCATGCAGG - Intergenic
1139401833 16:66688167-66688189 GGCACTAATCCCATTCATGAGGG + Intronic
1144384785 17:14739197-14739219 GGCACTAATCTCACTCATGTGGG - Intergenic
1144720772 17:17468405-17468427 GGCACTAATCCCATTCATGAGGG + Intergenic
1145849333 17:28076414-28076436 GGCACTAATCCCATTCATGAGGG + Intronic
1146625528 17:34432219-34432241 GGCACTAATCCCATTCATGAGGG - Intergenic
1146672129 17:34746947-34746969 ATCACTAATCCCAATCATGAGGG + Intergenic
1146993456 17:37296623-37296645 GGCACTAATCCCATTCATGAGGG + Intronic
1148981690 17:51581912-51581934 GGCACTAATCCTATTCACGTGGG - Intergenic
1149888432 17:60364204-60364226 GGCACTAATCCCATTCATGAGGG + Intronic
1150560368 17:66289167-66289189 GGCACTAATCCCATTCAGGATGG - Intergenic
1151290020 17:73142950-73142972 GGCACTAATCCCATTCATGAGGG - Intergenic
1151901661 17:77020017-77020039 GGCACTAATCCCATTCATGACGG + Intergenic
1153273031 18:3341986-3342008 GGCACTAATCCCATTCATGAGGG + Intergenic
1153275903 18:3367583-3367605 GGCACTAATCCCATTCATGAGGG + Intergenic
1153408839 18:4770756-4770778 AGCACTAATCCCATTCATGAGGG + Intergenic
1153437855 18:5086533-5086555 TGCCCAAAGCCCAATCAGGTGGG + Intergenic
1153470318 18:5437224-5437246 GGCACTAATCCCATTCATGAGGG - Intronic
1153517759 18:5920067-5920089 GGCACTAATCCCATTCATGAGGG - Intergenic
1153658853 18:7308735-7308757 GGCACTAATCCCATTCATGAGGG - Intergenic
1153679949 18:7491192-7491214 GGCACTAATCCCATTCATGAAGG - Intergenic
1154179476 18:12119581-12119603 AACACTAATCCCATTCAGGAGGG + Intronic
1154380299 18:13843598-13843620 AGCACTAATCCCATTCATGAGGG + Intergenic
1155159586 18:23184889-23184911 GGCACTAATCCCATTCATGAGGG + Intronic
1155485539 18:26337788-26337810 TGCACTAATCACTATCATGCTGG + Intronic
1155798192 18:30066387-30066409 GGCACTAATCCCATTCACGAGGG + Intergenic
1157035103 18:43962211-43962233 GGCACTAATCCCATTCATGAGGG - Intergenic
1157463188 18:47920214-47920236 GGCACTAATCCCATTCATGAGGG + Intronic
1157813592 18:50715575-50715597 GGCACTAATCCCATTCATGAGGG - Intronic
1158494966 18:57946783-57946805 GGCACTAATCCCATTCATGAGGG + Intergenic
1158513599 18:58112925-58112947 GGCACTAATCCCATTCATGAGGG - Intronic
1158703162 18:59767248-59767270 GGCACTAATCCCATTCATGAGGG - Intergenic
1158887872 18:61845947-61845969 GGCACTAACCCCACTCAGGAGGG - Intronic
1159109634 18:64042021-64042043 TGCACTAATCCCATTCATGAGGG + Intergenic
1159949973 18:74475765-74475787 GGCACTAATCCCATTCATGAAGG - Intergenic
1160052414 18:75447306-75447328 GGCACTAATCCCATTCATGAGGG - Intergenic
1160446110 18:78928013-78928035 GGCACAAATCCCATTCACGTTGG - Intergenic
1163408756 19:17140401-17140423 GGCACTAATCCCATTCATGAGGG + Intronic
1164760847 19:30727237-30727259 GGCACTAATCCCATTCATGAGGG + Intergenic
1164946679 19:32300344-32300366 GGCACTAATCCTAATCATGAGGG - Intergenic
1166007950 19:39919929-39919951 GGCACTAATCCCATTCATGAGGG - Intronic
1166902470 19:46076156-46076178 GGCACTAATCCCACTCATGAGGG + Intronic
1167729440 19:51242786-51242808 GGCACTAATCCCATTCATGGGGG + Intronic
1168413193 19:56152818-56152840 GGCACTAATCCCATTCATGAGGG + Intronic
1168490741 19:56806762-56806784 GGCACTAATCCCATTCATGAGGG - Intronic
1202664662 1_KI270708v1_random:107219-107241 TGCACTAATCCCAATCAGGATGG + Intergenic
1202682493 1_KI270712v1_random:20253-20275 GGCACTAATCCCATTCATATGGG + Intergenic
925006257 2:445096-445118 TGCACTATTCCCATGGAGGTCGG - Intergenic
925468993 2:4138752-4138774 GGCACTAATCCCAGTCAGGAAGG - Intergenic
925656860 2:6158416-6158438 TGCACTAAACCCTATCAGAAAGG + Intergenic
925833804 2:7923166-7923188 GGCACTAATCCCATTCATGAGGG + Intergenic
926365245 2:12127173-12127195 GGCACTAATCCCATTCATGAGGG - Intergenic
926426897 2:12746435-12746457 AGCACTAATCCCATTCATGAGGG + Intergenic
926427015 2:12747320-12747342 AGCACTAATCCCATTCATGAGGG + Intergenic
926626873 2:15097673-15097695 GACACTAATCCCACTCAGGAGGG + Intergenic
926834771 2:17006316-17006338 GGCACTAATCCCATTCATGAGGG + Intergenic
926886478 2:17603390-17603412 GGCACTAATCCCATTCATGAGGG + Intronic
927130937 2:20059890-20059912 GGCACTAATCCCATTCATGAGGG + Intergenic
927203884 2:20594889-20594911 GGCATTAATCCCAAACAGGAGGG + Intronic
927405966 2:22767138-22767160 GGCACTAATCCCATTCATGAGGG + Intergenic
928270784 2:29852781-29852803 GGCACTAATCCCATTCATGAGGG - Intronic
928653103 2:33422528-33422550 TGCACTAATCCCATTCATGAGGG - Intergenic
928719188 2:34099588-34099610 GGCACTAATCCCATTCATGAAGG - Intergenic
929129026 2:38547915-38547937 GGCACTAATCCCATTCATGAGGG - Intergenic
931627639 2:64271219-64271241 GGCACTAATCCCATTCATGAGGG - Intergenic
931995747 2:67837702-67837724 GGGACTAATCCCATTCATGTGGG + Intergenic
932261950 2:70334372-70334394 GGCACTAATCCCATTCATGAGGG - Intergenic
932652316 2:73571520-73571542 GGCACTAATCCCATTCATGAAGG + Intronic
933472419 2:82742814-82742836 GGCACTAATCCCATTCATGAGGG - Intergenic
933609716 2:84421583-84421605 GGCATTAATCCCATTCAGGAGGG - Intergenic
933739653 2:85523512-85523534 TGCAACAATCCTAATGAGGTAGG + Intergenic
934692898 2:96375414-96375436 AGCACTAATCCCATTCACGAGGG - Intergenic
935235330 2:101133642-101133664 AGCACTAATCACAATCAGGAAGG + Intronic
935262658 2:101368721-101368743 GACACTAATCCCATTCAGGAGGG - Intronic
935331924 2:101983412-101983434 TTCACTAATCCCATTCATGAAGG - Intergenic
935448434 2:103181431-103181453 GGCACTAATCCCACACAGGAAGG + Intergenic
935584846 2:104791365-104791387 TGCCCTAATTCCAAACAGGCTGG - Intergenic
935601528 2:104927181-104927203 GGCACTAATCCCACTCATGAGGG + Intergenic
936262409 2:110973117-110973139 AGCACTAATGCCAATCAGGATGG - Intronic
936406817 2:112212218-112212240 GGCACTAATCCCATTCATGAGGG + Exonic
936599822 2:113884859-113884881 AGAACTAATCCCATTCATGTGGG + Intergenic
936707131 2:115088139-115088161 GGCACTAATCCCATTCATGAGGG + Intronic
936896382 2:117432562-117432584 GGCACTAATCCCATTCATGAGGG + Intergenic
937441004 2:121916045-121916067 GGCACTAATCCCATTCATGAGGG + Intergenic
937589881 2:123600117-123600139 GGCACTAATGCCAATCATGAGGG - Intergenic
937651575 2:124325124-124325146 GGCACTAATCCCATTCATGAAGG - Intronic
937706273 2:124924386-124924408 AGCACTAATCCCATTCATGAGGG + Intergenic
938388160 2:130882492-130882514 GGCACTAATCCCACTCATGAGGG + Intronic
939392973 2:141592438-141592460 GGCACTAATCCCATTCATGAAGG + Intronic
939982911 2:148802179-148802201 GGCACTAATCCCATTCATGAGGG + Intergenic
940038862 2:149338500-149338522 GGCACTAATCCCACTCATGAGGG - Intronic
940413425 2:153392871-153392893 GGCACTAATCCCATTTAGGGGGG - Intergenic
941066963 2:160914309-160914331 GGCACTAATCCCATTCATGAGGG + Intergenic
941145409 2:161837861-161837883 GGCACTAATCCCAATCATAAGGG - Intronic
941262374 2:163313897-163313919 GGCACTAATCCCATTCAGGAGGG - Intergenic
941277869 2:163513595-163513617 GGCACTAATCCCATTCATGAGGG + Intergenic
941370102 2:164654509-164654531 GGCACTAATCCCATTCATGGGGG - Intronic
941686565 2:168454681-168454703 GGCACTAATCCCATTCATGAAGG - Intergenic
941835993 2:170021496-170021518 AGCACTAATCCCATTCATGAGGG + Intronic
942122098 2:172788116-172788138 AGCACTAATCCCATTCATGAGGG + Intronic
942426873 2:175869384-175869406 GGCACTAATCTCAATCAGGAGGG - Intergenic
942752766 2:179306621-179306643 GGCACTAATCCCATTCATGAAGG - Intergenic
943643825 2:190387048-190387070 GGCACTAATCCCACTCATGAGGG - Intergenic
943719494 2:191188992-191189014 AGCATTAATCCCATTCAGGAGGG + Intergenic
943759079 2:191588891-191588913 GGCACTAATCCCACTCATGAGGG - Intergenic
943800936 2:192056780-192056802 GGCACTAATCCCATTCATGAAGG - Intronic
944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG + Intergenic
944467614 2:200018842-200018864 AGCACTAATCCCATTCAAGTGGG + Intergenic
944577773 2:201106192-201106214 GGCACTAATCCCATTCATGAGGG - Intergenic
944636491 2:201680448-201680470 GGCACTAATCCCATTCATGAGGG + Intronic
944814278 2:203359745-203359767 GGCACTAATCCCATTCATGAAGG + Intronic
946113249 2:217438448-217438470 GGCACTAATCCCAACCATGAAGG - Intronic
947069828 2:226276238-226276260 GGCACTAATCCCATTCACGAAGG + Intergenic
947352382 2:229259808-229259830 GGCACTAATCCCATTCATGAAGG - Intronic
948286859 2:236792861-236792883 GGCACTAATCCCATTCACGAGGG + Intergenic
948782001 2:240327573-240327595 GGCACTAATCCCATTCATGAGGG - Intergenic
1168788407 20:559271-559293 GGCACTAATCCCACTCATGAGGG - Intergenic
1169315840 20:4590480-4590502 AGCACTTATCCCAATCATGAGGG - Intergenic
1169331409 20:4719358-4719380 GGCACTAATCCCAATCATAAGGG + Intergenic
1169408523 20:5347124-5347146 GGCACTAATCCCATTCATGTGGG + Intergenic
1169701963 20:8456863-8456885 GGCACTAATGCCATTCAGGAGGG + Intronic
1170148707 20:13205632-13205654 AGCACTAATCCCATTCATGAGGG + Intergenic
1170970590 20:21112682-21112704 AGCACTAATCCCATTCATGAGGG + Intergenic
1172168409 20:32913364-32913386 GGCACTAATCCCATTCATGAGGG + Intronic
1172478896 20:35259433-35259455 TGCACTAGTGGCAATCACGTGGG + Intronic
1173044098 20:39492879-39492901 GGCACTAATCCCATTCAAGAGGG - Intergenic
1173991481 20:47307119-47307141 GGCACTAATCCCATTCATGAGGG - Intronic
1174418265 20:50382224-50382246 TGTACTAATCACCTTCAGGTAGG - Intergenic
1174662333 20:52224391-52224413 GGCACTAATCCCATTCATGAGGG + Intergenic
1174866312 20:54139449-54139471 GGCACTAATCCCATTCATGAGGG + Intergenic
1175434241 20:58931475-58931497 GGCACTAATCCCATTCATGGGGG - Intergenic
1175973588 20:62699258-62699280 GGCACTAATCCCATTCATGAGGG - Intergenic
1176006907 20:62870316-62870338 GGCACTAATCCCATTCATGATGG + Intergenic
1176049339 20:63108379-63108401 GGCACTAATCCCATTCAGGAGGG - Intergenic
1176246820 20:64101504-64101526 GGCACTCATCCCATTCAGGAGGG + Intergenic
1176962024 21:15169814-15169836 GGCACTAATCCCAATCATGAGGG + Intergenic
1177036297 21:16047240-16047262 GGCACTAATCCCAGTCATGAGGG + Intergenic
1177197052 21:17914323-17914345 GGCACTAATCCCAAACATGGGGG + Intronic
1177506701 21:22028516-22028538 GGCACTAATCCCATTCATGAAGG - Intergenic
1177530488 21:22352384-22352406 GGCACTAATCCCACTCAAGAGGG + Intergenic
1177885361 21:26740180-26740202 AGCACTAATCCCATTCAAGAGGG + Intergenic
1178224720 21:30701979-30702001 AGCACTAATCCCATTCATGAGGG - Intergenic
1178289701 21:31356531-31356553 AGCACTAATCCCAATCCTGGGGG - Intronic
1178352701 21:31884235-31884257 GGCACTAATCCCATTCATGAGGG - Intronic
1178482070 21:32988110-32988132 GGCACTAATCCCATTCACGAGGG + Intergenic
1178483985 21:33005487-33005509 GGCACTAATCCCATTCAAGAGGG - Intergenic
1178966739 21:37127174-37127196 GGCACTAATCCCATTCATGAGGG + Intronic
1179058828 21:37960612-37960634 GGCACTAATCCCACTCAGGAGGG + Intronic
1179161150 21:38900464-38900486 GGCACTAATCCCATTCATGAGGG - Intergenic
1179236015 21:39546965-39546987 GGCACTAATCCCATTCATGAGGG + Intergenic
1179284869 21:39968612-39968634 GGCACTAATCCCATTCATGAGGG + Intergenic
1180331392 22:11484139-11484161 TGCACTAATCCCAATCAGGATGG + Intergenic
1181303693 22:21901797-21901819 AGCACTAATCCCATTCATGAGGG + Intergenic
1181643290 22:24216080-24216102 GGCACTAATCCCATTCATGAGGG - Intergenic
1182693836 22:32182937-32182959 GGCACTAATCCCATTCAAGAGGG + Intergenic
1182890700 22:33816485-33816507 GGCACTAATCCCACTCATGTAGG + Intronic
1182915325 22:34024124-34024146 GGCACTAATCCCATTCATGAAGG + Intergenic
1183498001 22:38161387-38161409 GGCACTAATCCCATTCATGAGGG + Intronic
1183611897 22:38914261-38914283 GGCACTAATCCCATTCATGAGGG - Intergenic
1184622593 22:45693524-45693546 GGCACTAATCCCATTCACGAGGG + Intronic
1185019793 22:48367504-48367526 GGCACTAATCCCATTCATGAGGG + Intergenic
949104555 3:188411-188433 GGCACTAATCCCAGTCATATGGG + Intergenic
949396481 3:3619641-3619663 TGGAGTATTCCCAATCAGTTTGG - Intergenic
949591153 3:5495771-5495793 GGCACTAATCCCATTCATGAGGG - Intergenic
949697622 3:6717496-6717518 GGCACTAATCCCACTCATGAGGG - Intergenic
949726914 3:7059723-7059745 AGCACTAATCCCATTCATGAGGG - Intronic
949957069 3:9277915-9277937 GGCACTAATCCCATTCATGAGGG - Intronic
950484876 3:13267123-13267145 AGCACTTATCCCAATCAGGAGGG - Intergenic
950507308 3:13403399-13403421 GGCACTAATCCCAACCATGAGGG + Intronic
950629016 3:14268897-14268919 GGCACTAATCCCATTCATGAGGG - Intergenic
950704425 3:14771109-14771131 GGCACTAATCCCATTCATGAGGG - Intronic
950832455 3:15888158-15888180 GGCACTAATCCCATTCATGAGGG - Intergenic
950944606 3:16931925-16931947 GGCACTAATCCCATTCATGAGGG - Intronic
951467568 3:23018886-23018908 GGCACTAATCCCATTCATGAGGG - Intergenic
951942188 3:28091788-28091810 GGCACTAATCCCATTCATGAGGG - Intergenic
952411492 3:33053757-33053779 GGCACTAATCCCATTCATGAAGG - Intronic
952585658 3:34889026-34889048 GGCACTAATCCCATTCAGGAAGG + Intergenic
952707010 3:36389393-36389415 GGCACTAATCCGAATCATGAAGG + Intronic
953549580 3:43891054-43891076 GGCACTAATCCCATTCATGAGGG - Intergenic
953552727 3:43916919-43916941 GGCACTAATCCCATTCAGGAGGG - Intergenic
954504770 3:51059242-51059264 GGCACTAATCCCATTCACGAGGG + Intronic
954514791 3:51164011-51164033 TGCATTAAAGCCAATCTGGTGGG - Intronic
955671512 3:61407829-61407851 GGCACTAATCCCATTCATGAGGG + Intergenic
955732295 3:61999366-61999388 TGCACTAATCCCATTCACGAGGG + Intronic
955847504 3:63181531-63181553 GGCACTAATCCCATTCATGAGGG + Intergenic
956118267 3:65940506-65940528 AGCACTAATCCCATTCATGAGGG + Intronic
956146074 3:66191990-66192012 GGCACTAAACCCATTCAGGAAGG - Intronic
957091274 3:75732514-75732536 TGCACTAATCCCAATCAGGTTGG - Intronic
957159733 3:76595010-76595032 GGCACTAATCCCATTCATGAGGG - Intronic
957549403 3:81684529-81684551 GGCACTAATCCCATTCATGAGGG + Intronic
957896941 3:86433248-86433270 GGCACTAATCCCAATAATGAGGG + Intergenic
958150363 3:89685346-89685368 GGCACTAATCCCATTCATGAGGG + Intergenic
958846507 3:99271282-99271304 GGCACTAATCCCATTCCTGTGGG - Intergenic
959110640 3:102118239-102118261 GGCACTAATCCCATTCATGAGGG + Intronic
959169551 3:102828625-102828647 TGCACTAATCCCATTCATAAGGG - Intergenic
959264873 3:104124521-104124543 GGCACTAATCCCATTCATGAGGG - Intergenic
959677274 3:109050465-109050487 TACACTAATGCCAATCACGAAGG + Intronic
960103215 3:113766614-113766636 GGCACTAATCCCATTCATGAGGG + Intronic
960461152 3:117937531-117937553 GGCACTAATCCCATTCATGAGGG - Intergenic
960694847 3:120386089-120386111 GGCACTAATCCCATTCATGAGGG - Intergenic
960848928 3:122031597-122031619 GGCACTAATCCCATTCATGAGGG - Intergenic
960905521 3:122597207-122597229 GGCACTAATCCCATTCATGAGGG + Intronic
961074867 3:123973041-123973063 GGCACTAATCCCATTCATGAGGG + Intronic
961308811 3:125979440-125979462 GGCACTAATCCCATTCATGAGGG - Intronic
962353081 3:134669955-134669977 GGCACTAATCCCATTCAGAAGGG - Intronic
962567529 3:136677594-136677616 GGCACTAATTCCATTCATGTTGG - Intronic
962850308 3:139303505-139303527 GGCACTAATCCCATTCATGAGGG + Intronic
963231703 3:142914917-142914939 GGCACTAATCCCATTCATGAGGG + Intergenic
963278143 3:143353372-143353394 GGCACTAATCCCATTCATGAGGG - Intronic
963892372 3:150650152-150650174 GGCACTAATCCCATTCATGAAGG - Intergenic
964492400 3:157250751-157250773 GGCACTAATCCCATTCATGAGGG + Intergenic
965307159 3:167080611-167080633 GGCACTAATCCTAATCATGAGGG + Intergenic
965378812 3:167961871-167961893 AGCACTAATCCCATTCAGGAGGG + Intergenic
965500216 3:169446848-169446870 TGCCCTCATCCCTATCAGGATGG + Intronic
965648473 3:170908817-170908839 TGCACTAATCCGCAGCACGTGGG - Intergenic
965988888 3:174791347-174791369 AGCACTAATCCCATTCATGAAGG - Intronic
966226688 3:177605459-177605481 GGCACTAATCCCATTCAAGAGGG - Intergenic
966380630 3:179341420-179341442 GGCACTAATCCCATTCATGAGGG - Intergenic
966763350 3:183436552-183436574 GGCACTAATCCCATTCATGAGGG - Intergenic
967579424 3:191135133-191135155 CGCACTAATCCCACTCAGGAGGG - Intergenic
969093332 4:4713279-4713301 GACACTAATCCCATTCAGGAGGG + Intergenic
969321042 4:6412805-6412827 GGCACTAATCCCATTCATGGGGG - Intronic
970083593 4:12319549-12319571 TGCACAAATCCCATTCATGAGGG + Intergenic
970113831 4:12670383-12670405 GGCACTAATCCCATTCATGAGGG - Intergenic
970128740 4:12843306-12843328 AGCACTAATCCCACTCATGAGGG + Intergenic
970340068 4:15096914-15096936 GGCACTAATCCCATTCATGAGGG - Intergenic
970447196 4:16134189-16134211 GGCACTAATCCCATTCATGATGG - Intergenic
970501981 4:16687291-16687313 GGCACTAATCCCATTCATGAGGG - Intronic
970675762 4:18448596-18448618 GGCACTAATCCCATTCATGAGGG - Intergenic
970871689 4:20823523-20823545 TGCACTAATCCCATTCATGAGGG - Intronic
971326134 4:25645399-25645421 TACACTAATCCCATTCATGAGGG + Intergenic
971450785 4:26799608-26799630 GGCACTAATCCCATTCATGAGGG - Intergenic
971500667 4:27314751-27314773 TGCACAAATCCCATTCATGAGGG - Intergenic
971974977 4:33673037-33673059 GGCACTAATCCCATTCAAGAGGG + Intergenic
972146774 4:36037606-36037628 TGCACTAAAACTAAGCAGGTTGG + Intronic
972383044 4:38536701-38536723 GGCACTAATCCCATTCATGAGGG - Intergenic
972389428 4:38600826-38600848 GGCACTAATCCCAATCATGCGGG + Intergenic
972624012 4:40778470-40778492 GGCACTAATCCCATTCATGAGGG - Intronic
972822399 4:42716759-42716781 GGCACTAATCCCATTCATGAGGG - Intergenic
972833018 4:42835804-42835826 GGCACTAATCCCATTCATGTAGG - Intergenic
973571202 4:52241477-52241499 GGCACTAATCCCATTCATGAGGG + Intergenic
973576141 4:52291237-52291259 GGCACTAATCCCATTCATGAGGG + Intergenic
973582063 4:52353871-52353893 GGCACTAATCCCATTCATGAGGG + Intergenic
973594520 4:52473175-52473197 GGCACTAATCCCACTCATGAGGG - Intergenic
973755349 4:54068320-54068342 GGCACTAATCCCATTCATGAGGG - Intronic
973855054 4:55002871-55002893 GGCACTAATCCCATTCATGAGGG - Intergenic
973916748 4:55641800-55641822 AGCACTAATCCCATTCATGAGGG - Intergenic
974368788 4:60987225-60987247 GGCACTAATCCCATTCATGCAGG + Intergenic
974579367 4:63776002-63776024 AGCACTAATCCCATTCATGAGGG - Intergenic
974688922 4:65270225-65270247 AGCATTAATCCCAATCAAGAGGG + Intergenic
975602172 4:76113075-76113097 AGCACTAATCCCATTCATGAAGG + Intergenic
975805077 4:78103642-78103664 GGCACTAACCCCAATCATGAGGG - Intronic
976179239 4:82383483-82383505 GGCACTAATCCCATTCATGAGGG + Intergenic
976598707 4:86918127-86918149 GGCACTAATCCCATTCATGAGGG + Intronic
976605887 4:86982537-86982559 GGCACTAATCCCATTCATGAAGG - Intronic
976668778 4:87628730-87628752 GGCACTAATCCCATTCATGAGGG - Intergenic
977335560 4:95694045-95694067 TTCATTAATCCCAATCATGAGGG + Intergenic
978156001 4:105489808-105489830 GGCACTAATCCCATTCATGAAGG - Intergenic
980196840 4:129600334-129600356 GGCACTAATCCCATTCATGAGGG - Intergenic
980594567 4:134936312-134936334 TGCACTTATTCCATTCATGTGGG - Intergenic
980916061 4:139034228-139034250 TGGATTAATACCAATAAGGTGGG - Intronic
981204878 4:142028516-142028538 TGAACCAATCTCAATCAGCTAGG + Exonic
981572753 4:146170385-146170407 GGCACTAATCCCATTCATGAGGG - Intergenic
981642756 4:146964102-146964124 GGCACTAATCCCATTCATGAGGG + Intergenic
981806782 4:148725131-148725153 GGCACTAATCCCATTCATGAGGG + Intergenic
981916691 4:150041520-150041542 TGCACTAATCCCATTCATGAGGG + Intergenic
982079777 4:151778152-151778174 GGCACTAATCCCATTCATGAGGG + Intergenic
982099599 4:151955043-151955065 GGCACTAATCCCATTCATGAGGG - Intergenic
982125958 4:152184112-152184134 GGCACTAATCCCATTCATGAGGG + Intergenic
982165198 4:152607858-152607880 GGCACTAATCCCATTCATGATGG - Intergenic
982699111 4:158639548-158639570 GGCACTAATCCCACTCATGAGGG - Intronic
983021446 4:162681057-162681079 TACACTAATCCCATTCATGCAGG + Intergenic
983266599 4:165514084-165514106 GTCACTAATCCCAATCATGAGGG + Intergenic
983432963 4:167674530-167674552 GGCACTAATTCCATTCATGTGGG + Intergenic
983656285 4:170088793-170088815 TGCACCAATCCCATTCAGGAGGG - Intronic
983712464 4:170735901-170735923 GGCAGTAATCCCATTCACGTGGG + Intergenic
983956594 4:173705407-173705429 GGCACTAATCCCATTCATGAGGG - Intergenic
984546319 4:181108424-181108446 GGCACTAATCCCATTCATGAAGG + Intergenic
984600373 4:181719578-181719600 GGCACTAATCCCATTCATGAAGG + Intergenic
985005015 4:185525726-185525748 GGCACTAATCCCATTCATGAGGG - Intronic
985818640 5:2145251-2145273 GGCACTAATCCCATTCAGGAGGG + Intergenic
985964331 5:3328453-3328475 GGCACTAATCCCATTCATGAGGG - Intergenic
986341835 5:6795622-6795644 TGCACTAATCCCATTCATAAAGG - Intergenic
986348463 5:6855757-6855779 GGCACTAATCCCATTCATGAGGG + Intergenic
986862180 5:11939557-11939579 GGCACTAATCCCATTCATGAGGG + Intergenic
987143551 5:14969247-14969269 GGCACTAATCCCATTCATGAGGG + Intergenic
987299766 5:16586976-16586998 GGCACTAATCCCATTCATGAGGG + Intronic
987333435 5:16876961-16876983 GGCACTAATCCCATTCATGAAGG - Intronic
987511360 5:18844543-18844565 TGCACTAATTCCATTCATGAAGG - Intergenic
987550173 5:19369248-19369270 GGCACTAATCCCATTCATGGAGG + Intergenic
987718190 5:21598294-21598316 GGCACTAATTCCAATCATGAAGG + Intergenic
987872020 5:23631610-23631632 AGCACTAATCCCATTCTGGTGGG + Intergenic
987965554 5:24867691-24867713 GGCACTAATCCCACTCATGAGGG + Intergenic
987994497 5:25258379-25258401 GGCACTAATCCCATTAAAGTGGG - Intergenic
988515384 5:31899761-31899783 GGCACTAATCCCATTCATGAGGG - Intronic
988523694 5:31968111-31968133 TGCACTAATCCCATTCATGAAGG - Intronic
988777914 5:34493774-34493796 GGCACTAATCCCATTCATGAGGG - Intergenic
988821222 5:34888073-34888095 GGCACTAATCCCATTCATGAAGG - Intronic
989323018 5:40159137-40159159 GGCACTAATCCCAATCATTAGGG - Intergenic
989399634 5:40994823-40994845 GGCACTAATCCCATTCATGAGGG - Intergenic
989450432 5:41580919-41580941 GGCACTAATCCCATTCATGAGGG + Intergenic
990377225 5:55183612-55183634 GGCACTAATCCCATTCATGAGGG + Intergenic
990949655 5:61286155-61286177 GGCACTAATCCCATTCATGAGGG + Intergenic
991322092 5:65385035-65385057 GGCACTAATCCCATTCATGAAGG + Intronic
991395984 5:66205971-66205993 AGCACTAATCCCATTCATGAGGG + Intergenic
991922599 5:71671625-71671647 TGCACTAAGCCCAATCTGTATGG - Intergenic
991953720 5:71971781-71971803 GGCACTAATCCCACTCATGAAGG + Intergenic
992154638 5:73943001-73943023 GGCACTAATCCCATTCATGAGGG - Intergenic
992365846 5:76088537-76088559 GGCACTAATCCCATTCATGAGGG + Intronic
993309141 5:86307083-86307105 GGCATTAATCCCAATCATGAGGG + Intergenic
993353048 5:86873442-86873464 TGCACTAAGCCCCAACAGATCGG + Intergenic
993699107 5:91097287-91097309 TGCACTAATCCCATTCATGAGGG + Intronic
993825784 5:92684934-92684956 GGCACTAATCCCATTCATGAGGG + Intergenic
994090442 5:95805316-95805338 GGCACTAATCCCATTCATGAGGG + Intronic
994223744 5:97228009-97228031 GGCACTAATCCCATTCATGAGGG + Intergenic
994280326 5:97894072-97894094 GGCACTAATCCCAATTATGATGG + Intergenic
994369100 5:98948661-98948683 GGCACTAATGCCAATCATGAGGG + Intergenic
995280641 5:110331711-110331733 GGCACTAATCCCATTCATGAGGG - Intronic
995755493 5:115499246-115499268 GGCACTAATCCCATTCATGAGGG + Intergenic
996178683 5:120391857-120391879 GGCACTAATCCCATTCATGAGGG - Intergenic
996214016 5:120845824-120845846 GGCACTAATCCCATTCATGAAGG - Intergenic
996571875 5:124940511-124940533 GGCACTAATCCCATTCAGGAGGG + Intergenic
996645905 5:125816758-125816780 GGCACTAATCCCATTCATGAGGG + Intergenic
996683596 5:126255789-126255811 GGCACTAATCCCATTCATGGGGG + Intergenic
996728881 5:126697955-126697977 AGCACTAATCCCATTCATGATGG + Intergenic
996764316 5:127020527-127020549 GGCACTAATCCCATTCAGGAGGG - Intronic
996860477 5:128060223-128060245 AGCACTAATCCCATTCATGAGGG + Intergenic
997132705 5:131293177-131293199 AGCACTAATCCCATTCATGAGGG - Intronic
997223505 5:132191135-132191157 GGCACTAATCCCACTCACGTGGG + Intergenic
997847032 5:137296030-137296052 GGCACTAATCCCATTCATGAGGG - Intronic
997901001 5:137764233-137764255 GGCACTAATCCCATTCATGAGGG - Intergenic
998585513 5:143422549-143422571 GGCACTAATCCCATTCATGAGGG - Intronic
998766280 5:145491340-145491362 GGCACTAGTCCCAGTCAGGAGGG + Intronic
999441009 5:151600848-151600870 GGCACTAATCCCATTCATGAGGG - Intergenic
999698858 5:154209662-154209684 GGCACTAATCCCATTCACGATGG + Intronic
999838048 5:155395580-155395602 TGCACTAATCCCATTAATGAGGG - Intergenic
999902580 5:156101001-156101023 TGCACAAATCCCATTCATGAGGG - Intronic
1000690627 5:164315205-164315227 GGCACTAATCCCAATCATAAAGG + Intergenic
1000738888 5:164939620-164939642 AACACTAATCCCAATCATGAGGG + Intergenic
1001148750 5:169207813-169207835 AGCACTAATCCCATTCATGAGGG - Intronic
1001268097 5:170289797-170289819 TGAACTACTCCCACTCAGGGAGG + Intronic
1001630405 5:173170831-173170853 GGCACTAATCCCATTCATGAGGG - Intergenic
1001836823 5:174839640-174839662 GGCACTAATCCCATTCATGAGGG - Intergenic
1002873839 6:1192569-1192591 TGTACTTATACCAATAAGGTAGG - Intergenic
1003613017 6:7630283-7630305 GGCACTAATCCCATTCATGAGGG - Intergenic
1003787842 6:9506994-9507016 GGCACTAATCCCATTCAAGAGGG + Intergenic
1003846886 6:10183049-10183071 GGCACTAATCCCATTCATGAGGG - Intronic
1003863437 6:10342561-10342583 AGCACTAATCCCATTCATGATGG + Intergenic
1004072099 6:12309167-12309189 GGCACTAATCCCATTCATGAGGG - Intergenic
1004759815 6:18654283-18654305 GGCACTAATCCCATCCATGTGGG - Intergenic
1007944995 6:45818131-45818153 GGCACTAATCCCATTCATGAGGG - Intergenic
1008679062 6:53853129-53853151 GGCACTAATCCCATTCATGAGGG + Intronic
1008869978 6:56261457-56261479 GGCACTAATCCCATTCATGAGGG - Intronic
1009041778 6:58188932-58188954 GGCACTAATCCCATTCATGAGGG + Intergenic
1009217628 6:60943195-60943217 GGCACTAATCCCATTCATGAGGG + Intergenic
1009790431 6:68394561-68394583 GGCACTAATCCCATTCATGAGGG + Intergenic
1010278335 6:73994696-73994718 GGCACTAATCCCATTCATGAGGG + Intergenic
1010380330 6:75216745-75216767 TGCACTAATCCCATTCATGAGGG + Intergenic
1010554845 6:77266219-77266241 GGCACTAATCCCATTCATGAGGG + Intergenic
1010671258 6:78689448-78689470 GGCACTAATCCCACTCATGAGGG - Intergenic
1010673013 6:78709153-78709175 AGCACTAATCCCATTCATGAGGG + Intergenic
1010726304 6:79337591-79337613 GGCACTAATCCCAATCTTGAGGG - Intergenic
1010731033 6:79391561-79391583 GGCACTAATCCCATTCATGAGGG + Intergenic
1010930902 6:81801744-81801766 GACACTAATCCCATTCAGGAGGG - Intergenic
1011003949 6:82622825-82622847 GGCACTAATCCCATTCATGAGGG - Intergenic
1011009837 6:82691504-82691526 AGCACTAATCCCATTCATGAGGG + Intergenic
1011156860 6:84342903-84342925 GGCACTAATCCCACTCATGCAGG + Intergenic
1012362332 6:98398045-98398067 TGTACTAATCAAAATCAGTTTGG - Intergenic
1012795991 6:103762014-103762036 AGCACTAATCCCATTCATGAGGG + Intergenic
1013374993 6:109506022-109506044 GGCACTAATCCCATTCATGAGGG + Intronic
1013446868 6:110238074-110238096 TGCACTAATCCCATTCACAAGGG + Intronic
1013632062 6:111995577-111995599 GGCACTAATCCCATTCATGAAGG + Intergenic
1013715355 6:112954570-112954592 GGCACTAATCCCATTCATGAGGG - Intergenic
1014121951 6:117736145-117736167 GGCACTAATCCCATTCATGAGGG - Intergenic
1014168132 6:118248928-118248950 GGCACTAATACCATTCAGGATGG - Intronic
1014302657 6:119701777-119701799 GGCACTAATCCCAATCATGAGGG - Intergenic
1014666954 6:124250068-124250090 GGCACTAATTCCATTCAGGAGGG - Intronic
1015091867 6:129368123-129368145 GGCACTAATCCCAATCATGAAGG + Intronic
1015234361 6:130953718-130953740 GGCACTAATCCCAGTCATGAAGG - Intronic
1015770157 6:136760649-136760671 GGCACTAATCCCATTCATGAGGG - Intronic
1015777517 6:136829426-136829448 AGCACTAATCCCATTCATGAGGG + Intronic
1015797239 6:137025267-137025289 GGCACTAATCCCACTCATGAGGG - Intronic
1016019426 6:139220102-139220124 GGCACTAATCCCATTCATGAGGG - Intergenic
1016133411 6:140506724-140506746 GGCACTAATCCCATTCATGAGGG - Intergenic
1016265407 6:142227446-142227468 GGCACTAATCCCATTCATGAAGG + Intergenic
1016371851 6:143382966-143382988 GGCACTAATCCCATTCATGAGGG + Intergenic
1016683817 6:146859467-146859489 GGCACTAATCCCATTCATGGGGG - Intergenic
1016926623 6:149356610-149356632 GCCACTAATCCCATTCATGTAGG + Intronic
1017186977 6:151611520-151611542 AGCACTAATCCCATTCAAGATGG + Intronic
1017317654 6:153050936-153050958 AGCACTAATCCCATTCATGAAGG - Intronic
1017459224 6:154633494-154633516 GGCACTAATCCCATTCATGAGGG - Intergenic
1017721130 6:157243917-157243939 GGCACTAATCCCATTCATGAAGG - Intergenic
1017937281 6:159016877-159016899 GGCACTAATCCCACTCATGAGGG + Intergenic
1018256751 6:161928065-161928087 GACACTAATCCCAATCATGAAGG - Intronic
1018288693 6:162268297-162268319 GGCACTAATCCCATTCATGAAGG - Intronic
1018692019 6:166354202-166354224 GGCACTAATCCCATTCACATGGG - Intergenic
1020814741 7:12891551-12891573 GGCACTAATCCCATTCATGAGGG - Intergenic
1021225495 7:18021384-18021406 GGCACTAATCCCATTCATGGGGG - Intergenic
1021767306 7:23962906-23962928 GGCACTAATCCCATTCACGAGGG - Intergenic
1021910445 7:25380693-25380715 GGCACTAATCCCATTCATGATGG - Intergenic
1021987021 7:26106914-26106936 AGCACTAATCCCATTCAAGACGG + Intergenic
1022336547 7:29427189-29427211 TGCAGTAATCCCAGTTACGTGGG + Intronic
1022796785 7:33738067-33738089 GGCACTAATCCCATTCATGATGG - Intergenic
1022842811 7:34180819-34180841 GGCACTAATCCCATTCATGAGGG - Intergenic
1022876094 7:34531953-34531975 AGCACTAATCCCATTTATGTGGG - Intergenic
1023571025 7:41572027-41572049 GGCACTAATCCAATTCATGTGGG - Intergenic
1024135210 7:46399778-46399800 GGCACTAATCCCATTCACGAGGG - Intergenic
1024315539 7:48012835-48012857 AGCACTAATCCTATTCACGTGGG - Intronic
1024325420 7:48105766-48105788 GGCACTAATCCCACTCATGCAGG + Intronic
1024509039 7:50188358-50188380 GGCACTAATCCCATTCATGAGGG - Intergenic
1024606363 7:51025501-51025523 AGCACTAATCCCATTCATGAGGG - Intronic
1024833099 7:53484830-53484852 TGCACTAATCGCATTCATGAGGG - Intergenic
1024844610 7:53627925-53627947 AGCACTAATCCCAATTAAGAGGG - Intergenic
1025252721 7:57362648-57362670 TGAACTAATCACATTCAGGTGGG + Intergenic
1025986522 7:66457741-66457763 TGCACTAATCCCAATCATGAGGG + Intergenic
1026003116 7:66578650-66578672 TGCACTAATCCCAATCATGAGGG + Intergenic
1026111791 7:67464263-67464285 GGCACTAATCCCATTCATGAGGG + Intergenic
1026509626 7:71017236-71017258 TGCACTAATCCTATTCATGGGGG + Intergenic
1026658310 7:72276469-72276491 GGCACTAATCCCATTCATGAGGG - Intronic
1026995663 7:74614384-74614406 GGCACTAATCCCATTCATGAAGG - Intergenic
1027209790 7:76136593-76136615 TGCACTAATCCCAATCATGAGGG + Intergenic
1027819209 7:83022111-83022133 GGCACTAATCCCATTCATGAGGG - Intronic
1028310235 7:89323044-89323066 GGCACTAATCCCACTCACGAAGG - Intronic
1028416784 7:90589164-90589186 GGCACTAATCCCATTCATGAGGG - Intronic
1029003477 7:97182024-97182046 GGCACTAATCCCATTCATGAGGG - Intergenic
1029502318 7:100939534-100939556 GGCACTAATCCCATTCATGAGGG - Intergenic
1029804438 7:102981746-102981768 GGCACTAATCCCATTCATGAGGG + Intronic
1030276803 7:107729911-107729933 GGCACTAATCCCATTCATGAGGG - Intergenic
1030740487 7:113103392-113103414 GGCACTAATCCCATTCATGAGGG + Intergenic
1030865993 7:114702392-114702414 GGCACTAATCCCATTCATGAGGG - Intergenic
1031285642 7:119863838-119863860 AGCACTAATCCCATTCAGGAGGG - Intergenic
1031628284 7:124015796-124015818 GGCACTAGTCCCAATCATGAGGG + Intergenic
1032715671 7:134507124-134507146 GGCACTAATCCCATTCATGAAGG - Intergenic
1032794334 7:135265706-135265728 GGCACTAATTCCATTCACGTGGG - Intergenic
1033138916 7:138807955-138807977 GGCACTAATCCCAATCGTGAGGG + Intronic
1033846909 7:145444504-145444526 GGCACTAATCCCATTCATGAAGG + Intergenic
1033944811 7:146703712-146703734 GGCACTAATCCCATTCATGAAGG + Intronic
1034100823 7:148448976-148448998 GGCACTAATCCCATTCAGGAGGG - Intergenic
1034842460 7:154412128-154412150 GGCACTCATCCCATTCAGGAGGG + Intronic
1034882033 7:154770098-154770120 GGCACTAATCCCAATCATGAAGG - Intronic
1035837552 8:2770732-2770754 GGCACTGATCCCATTCAGGAAGG + Intergenic
1036161486 8:6392990-6393012 GGCACTAATCCCACTCATGAGGG - Intergenic
1036439213 8:8765527-8765549 GGCACTAATCCCATTCATGAGGG + Intergenic
1036586873 8:10132639-10132661 GGCACTAATCCCATTCATGATGG + Intronic
1036677540 8:10847457-10847479 GGCATTAATCCCATTCATGTGGG - Intergenic
1037002025 8:13731690-13731712 GGCACTAATCCCAATCAGAAGGG - Intergenic
1037174931 8:15935859-15935881 GGCACTAATCCCATTCATGAGGG + Intergenic
1037625735 8:20605336-20605358 GGCACTAATCCTATTCAGGAGGG - Intergenic
1037669336 8:21000897-21000919 GGCACTAATCTCAATCAGGAGGG - Intergenic
1038154272 8:24973048-24973070 AACACTAATCCCATTCATGTGGG + Intergenic
1038159740 8:25025200-25025222 GGCACTAATCCCATTCATGAGGG + Intergenic
1038161765 8:25046387-25046409 GGCACTAATCCCATTCATGAGGG - Intergenic
1038366631 8:26942344-26942366 GGCACTAATCCCATTCATGTAGG + Intergenic
1038394297 8:27235719-27235741 GGCACTAATCCCATTCATGAAGG - Exonic
1039148092 8:34472285-34472307 GGCACTAACCCCAATCAGGAGGG - Intergenic
1039179181 8:34845341-34845363 TGCACTAAACCCAGACAAGTAGG + Intergenic
1040406067 8:47104197-47104219 GGCACTAATCCCATTCATGAGGG - Intergenic
1040781124 8:51110678-51110700 AGCAGTAATCCCAATCATGAAGG - Intergenic
1041290750 8:56306184-56306206 GGCACTAATCCCATTCATGAGGG - Intronic
1041742801 8:61175257-61175279 GGCACTAATCCCATTCATGAGGG - Intronic
1041862394 8:62529496-62529518 GGCACTAATCCCATTCAGGAGGG - Intronic
1041909316 8:63071693-63071715 GGCACTAATCCCATTCATGAGGG - Intronic
1042659681 8:71140898-71140920 GGCACTAATCCCATTCATGAGGG + Intergenic
1042691860 8:71508582-71508604 GCCACTAATCCCATTCAGGAGGG - Intronic
1042941476 8:74113034-74113056 GGCACTAATCCCACTGAGGAAGG - Intergenic
1043411104 8:79996545-79996567 TTCACTAATCCCACTCACGAGGG + Intronic
1043581345 8:81719736-81719758 TCCACTAGTCCCAAACAGATAGG + Intronic
1043602568 8:81958385-81958407 GGCACTAATCCCATTCATGAGGG - Intergenic
1043715626 8:83481904-83481926 GGCACTAATCCCATTCATGAGGG - Intergenic
1044725659 8:95192394-95192416 GGCACTAATCCCATTCAGGAGGG - Intergenic
1044926278 8:97211490-97211512 GGCACTAATCCCACTCATGCGGG + Intergenic
1045465644 8:102467358-102467380 TGCACTTCTCCCGAGCAGGTGGG - Intergenic
1045572329 8:103381014-103381036 TGCACTAACCTCAATCAAATAGG + Intronic
1045669580 8:104534031-104534053 TTCACTAAGCCCTATAAGGTAGG - Intronic
1046040514 8:108897762-108897784 AGCACTAATCCCATTCATGAGGG + Intergenic
1046079439 8:109353397-109353419 GACACTAATCCCATTCATGTGGG + Intergenic
1046591361 8:116211082-116211104 TGCACAATTCCCAATCATTTTGG + Intergenic
1046622001 8:116538054-116538076 GACACTAATCCCATTCAGGAGGG - Intergenic
1046724766 8:117662541-117662563 GGCACCAATCCCAATCATGAGGG + Intergenic
1046902349 8:119536832-119536854 GGCACTAATCCCATTCATGAGGG - Intergenic
1046953372 8:120039136-120039158 GGCACTAATCCCATTCATGAGGG - Intronic
1047046907 8:121064027-121064049 GGCACTAATCCCATTCATGAGGG + Intergenic
1047820673 8:128516732-128516754 GGCACTAATCCCATTCATGAGGG - Intergenic
1047896184 8:129368959-129368981 GGCACTAATCCCATTCATGAGGG - Intergenic
1048519391 8:135139756-135139778 GGCACTACTCCCATTCAGGAGGG + Intergenic
1048713331 8:137238764-137238786 GGCACTAATCCCACTCAGGAGGG + Intergenic
1048841805 8:138573096-138573118 GGCACTAATCCCATTCATGAGGG + Intergenic
1049083742 8:140461892-140461914 CGCACTAATCCCATTCATGGGGG + Intergenic
1049135471 8:140894149-140894171 GGCACTAATCCCATTCATGAGGG - Intronic
1049890791 9:68865-68887 GGCACTAATTCCAATCATGAGGG - Intergenic
1050327507 9:4511379-4511401 GGCACTAATCCCATTCAGGAGGG + Intronic
1050352194 9:4750901-4750923 GGCACTAAACCCACTCAGGAGGG + Intergenic
1051467197 9:17393181-17393203 AGCACTAATCCCATTCATGAGGG + Intronic
1051550993 9:18329106-18329128 GGCACTAATCCCATTCATGAGGG - Intergenic
1051699314 9:19802911-19802933 AGCACTAATCCCATTCATGAGGG - Intergenic
1051970714 9:22884229-22884251 TGCACTAATCCTATTCATGAGGG + Intergenic
1052220853 9:26020004-26020026 TGCTCTAATTCCAATCAGGATGG - Intergenic
1053272255 9:36758518-36758540 GGCACTAATCCCATTCAGGAGGG - Intergenic
1053732257 9:41070051-41070073 GGCACTAATTCCAATCATGAAGG - Intergenic
1053944308 9:43290448-43290470 GGCACTAATCCCATTCATATGGG - Intergenic
1054696196 9:68361666-68361688 GGCACTAATTCCAATCATGAGGG + Intronic
1054765704 9:69040836-69040858 GGCACTAATCCCAATCATATGGG - Intronic
1054812653 9:69447131-69447153 GGCACTAATCCCAACCATGAGGG + Intronic
1054862764 9:69970296-69970318 AGCACTAATCCCATTCATGAGGG + Intergenic
1055618200 9:78095056-78095078 GGCACTAATCCCATTCATGAGGG - Intergenic
1055728697 9:79258681-79258703 GGCACTAATCCCATTCATGAGGG - Intergenic
1056219290 9:84435544-84435566 GGCACTAATCCCATTCATGAGGG + Intergenic
1056335315 9:85562920-85562942 GGCACTAATCCCATTCAAGAGGG - Intronic
1056418872 9:86404213-86404235 GGCACTAATCCCATTCAAGAGGG - Intergenic
1056693348 9:88826427-88826449 GGCACTAATCCCATTCATGAGGG - Intergenic
1056842830 9:90012588-90012610 GGCACTAATCCCATTCATGGGGG - Intergenic
1057056270 9:91963642-91963664 GGAACTAATCCCATTCAGGAGGG - Intergenic
1057706341 9:97397740-97397762 GGCACTAATCCCATTCATGAGGG + Intergenic
1057878130 9:98773094-98773116 TCCACTATTCTCGATCAGGTAGG - Intronic
1058335855 9:103828187-103828209 GGCACTAATCCCATTCATGAGGG - Intergenic
1058541275 9:106014930-106014952 GGCACTAATCCCATTCATGAGGG + Intergenic
1058560331 9:106221724-106221746 AGCACTAATCCCATTCATGAGGG - Intergenic
1058608398 9:106748471-106748493 GGTACTAATCCCAATCATGAAGG + Intergenic
1058794804 9:108487884-108487906 GGCACTAATCCCATTCATGAGGG + Intergenic
1059370193 9:113824428-113824450 GGCACTAATCCCATTCATGAAGG - Intergenic
1059613393 9:115923250-115923272 GGCACTAATCCCATTCATGAGGG + Intergenic
1059829151 9:118073083-118073105 TTGACTAATCCCAATCATGAAGG - Intergenic
1059928361 9:119236030-119236052 TGGACCAATCCCAATCTAGTAGG - Intronic
1059999034 9:119941769-119941791 GGCACTAATCCCATTCATGAGGG - Intergenic
1060146025 9:121253117-121253139 GGCACTAATCCCATTCATGAGGG + Intronic
1060794669 9:126505717-126505739 TGCACGAGCCCCACTCAGGTGGG - Exonic
1062169759 9:135128488-135128510 TGCACTAGTCCCAGGCAGGCGGG + Intergenic
1203587444 Un_KI270747v1:19026-19048 GGCACTAATCCCATTCATATGGG - Intergenic
1186117397 X:6319314-6319336 GGCACTAATCCCATTCCTGTGGG + Intergenic
1186281564 X:7998747-7998769 GGCACTAATCCCATTCATGAGGG - Intergenic
1186530625 X:10291561-10291583 GGCACTAATCCCATTCATGGGGG + Intergenic
1186689715 X:11962387-11962409 AGCACTAATCCCATTCATGAGGG + Intergenic
1186690103 X:11966282-11966304 GGCACTAATCCCATTCATGAGGG - Intergenic
1187420640 X:19130702-19130724 GGCACTAATCCCATTCATGAGGG - Intergenic
1187762061 X:22598265-22598287 TGCACTGATCCCAATTATGAGGG - Intergenic
1188315446 X:28667859-28667881 GGCACTAATCCCATTCATGAGGG + Intronic
1188386930 X:29573158-29573180 GGCATTAATCCCATTCAGGAGGG + Intronic
1188691645 X:33136600-33136622 GGCACTAATCCCATTCATGAGGG - Intronic
1189068367 X:37836304-37836326 GGCACTAATCCCAATCATGAGGG - Intronic
1189367135 X:40397525-40397547 GGCACTAATCCCACTCATGAGGG + Intergenic
1189526462 X:41827501-41827523 AGCACTAATCCCATTCACGAGGG + Intronic
1189797428 X:44658919-44658941 GGCACTAATCCCACTCACGAGGG + Intergenic
1190550429 X:51574179-51574201 AGCACTAATCCCATTCATGAGGG - Intergenic
1190762338 X:53446945-53446967 AGCACTAATCCCACTCATGAAGG - Intergenic
1190959323 X:55229518-55229540 GGCACTAATCCCATTCATGAGGG - Intronic
1192134532 X:68584547-68584569 TGGCCTAATCCCCATGAGGTTGG - Intergenic
1192200618 X:69064356-69064378 GGCACTAATCCCATTCATGAGGG + Intergenic
1192522728 X:71815946-71815968 TGCACAAATCCCACTCAGAGAGG - Intergenic
1192533001 X:71905412-71905434 GGCACTAATCCCATTCATGAGGG - Intergenic
1193752177 X:85359329-85359351 TGCAATACTTCCAAGCAGGTTGG - Intronic
1194745163 X:97620389-97620411 GGCACTAATCCCAATCATAAGGG + Intergenic
1194957355 X:100196609-100196631 GGCACTAATCCCATTCATGAGGG - Intergenic
1195118282 X:101722255-101722277 TGCACTAATCCCATTCATGAGGG - Intergenic
1195284425 X:103369900-103369922 AGCACTAATCCCATTCATGAGGG - Intergenic
1195462156 X:105139678-105139700 GGCACTAATCCCATTCATGAGGG + Intronic
1195718683 X:107844104-107844126 GCCACTAATCCTAATCAGGGAGG - Intronic
1196129608 X:112140634-112140656 GGCACTAATCCCATTCATGAGGG + Intergenic
1196251105 X:113460867-113460889 GGCACTAATCCCATTCATGAAGG + Intergenic
1196327274 X:114421576-114421598 GGCACTAATCCCATTCATGAGGG + Intergenic
1196404061 X:115346174-115346196 GGCACTAATCCCATTCATGAGGG - Intergenic
1196410427 X:115412600-115412622 TGCACTAATCCCATTCATGAGGG + Intergenic
1196536071 X:116845929-116845951 GGCACTAATCTCATTCATGTGGG + Intergenic
1196577198 X:117333101-117333123 AGCACTAATCCCATTCATGAGGG - Intergenic
1196931299 X:120684445-120684467 GGCACTAATCCCATTCATGAGGG + Intergenic
1197115284 X:122824884-122824906 TGCACTAATCCCATTCATGAGGG + Intergenic
1197596029 X:128465104-128465126 GGCACTAATCCCATTCATGAGGG - Intergenic
1197828086 X:130612315-130612337 GGCACTAATCCCAATCGTGAGGG + Intergenic
1197830778 X:130640119-130640141 TGTACTAATCCCATTCATGAAGG + Intronic
1197846126 X:130804976-130804998 GACACTAATCCCATTCATGTGGG - Intronic
1198463969 X:136888290-136888312 GGCACTAATCCCATTCATGATGG - Intergenic
1198591906 X:138192878-138192900 GGCACTAATCCAATTCAGGAGGG - Intergenic
1199119511 X:144034994-144035016 GGCACTAATCCCATTTATGTGGG - Intergenic
1199156675 X:144557469-144557491 GGCACTAATCCCATTCATGAGGG + Intergenic
1199692412 X:150318655-150318677 GGCACTAATGCCAATCAAGAGGG + Intergenic
1199910917 X:152285813-152285835 AGCACTAATCCCAATCATGAGGG + Intronic
1200180870 X:154150018-154150040 GGCACTAATCCCATTCATGAGGG + Intronic
1200186513 X:154187132-154187154 GGCACTAATCCCATTCATGAGGG + Intergenic
1200192165 X:154224270-154224292 GGCACTAATCCCATTCATGAGGG + Intronic
1200197920 X:154262074-154262096 GGCACTAATCCCATTCATGAGGG + Intronic
1201220031 Y:11760035-11760057 TGCACTAATCCCATCCATGAGGG + Intergenic
1201451641 Y:14121870-14121892 GGCACTAATCCCATTCATGAAGG - Intergenic
1201480309 Y:14431760-14431782 AGCACTAATCCCATTCCTGTGGG + Intergenic
1201597135 Y:15682901-15682923 TGCATTAATCCCATCCAGGAGGG - Intergenic
1201632822 Y:16088147-16088169 GGCACAAATCCCATTCAGGAGGG + Intergenic
1201642590 Y:16195349-16195371 AGCACTAATTCCATTCATGTGGG + Intergenic
1201660225 Y:16389972-16389994 AGCACTAATTCCATTCATGTGGG - Intergenic
1202054205 Y:20813210-20813232 TGCACTGAACCCAAACAGGCTGG - Intergenic