ID: 957093179

View in Genome Browser
Species Human (GRCh38)
Location 3:75752070-75752092
Sequence GGTCTGACTAACCCTCACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957093175_957093179 9 Left 957093175 3:75752038-75752060 CCTCACATGGGATTCCAGAACAC 0: 89
1: 1538
2: 2746
3: 2691
4: 1771
Right 957093179 3:75752070-75752092 GGTCTGACTAACCCTCACATAGG 0: 1
1: 0
2: 4
3: 9
4: 82
957093177_957093179 -5 Left 957093177 3:75752052-75752074 CCAGAACACTCCTGCTGTGGTCT 0: 206
1: 451
2: 786
3: 1375
4: 1788
Right 957093179 3:75752070-75752092 GGTCTGACTAACCCTCACATAGG 0: 1
1: 0
2: 4
3: 9
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957093179 Original CRISPR GGTCTGACTAACCCTCACAT AGG Intronic
900565656 1:3330761-3330783 GGTCTGACTCGCCCTCGCTTAGG - Intronic
901264764 1:7902199-7902221 GGTCTGTATAACCCTCACCCGGG - Intergenic
902261684 1:15229998-15230020 GGGCTGGGTAACCCTGACATGGG + Intergenic
911510568 1:98804433-98804455 GCTCTGAGTAACTCTCACAGTGG - Intergenic
920400166 1:205671141-205671163 GGGCTGGCTGACCCTCACCTTGG + Intronic
1076302551 10:129439000-129439022 GGTCTCCCTGACCCACACATGGG + Intergenic
1076314845 10:129532851-129532873 TGTCTGACCAGCCCCCACATGGG + Intronic
1076321950 10:129589672-129589694 GGGCTGCTTAACGCTCACATGGG + Intronic
1105230883 13:18494534-18494556 GGTCTGAATGTCCCGCACATAGG - Intergenic
1105231439 13:18499931-18499953 GATCTGAGTGTCCCTCACATAGG - Intergenic
1111449014 13:88390374-88390396 GGTCTGAATACCCCTTCCATGGG - Intergenic
1113858566 13:113465287-113465309 GATCAGACTAATCCTCACTTTGG + Intronic
1119946942 14:78705051-78705073 GGTCTTACTATCCCACCCATGGG - Intronic
1202838118 14_GL000009v2_random:93833-93855 GGTCTGAATGTCCCTGACATAGG + Intergenic
1202907474 14_GL000194v1_random:83752-83774 GGTCTGAATGTCCCTGACATAGG + Intergenic
1202885577 14_KI270722v1_random:103901-103923 GGTCTGAATGTCCCTGACATAGG - Intergenic
1202887007 14_KI270722v1_random:117180-117202 GGTCTGACTGTCCCTCACATAGG - Intergenic
1125328238 15:38558887-38558909 GATCTGACTAAGCCTCCCTTAGG + Intronic
1130773935 15:86956639-86956661 TGTGTGACTAACATTCACATCGG - Intronic
1203158866 17_GL000205v2_random:30725-30747 GGTCTATTTGACCCTCACATAGG - Intergenic
1153730447 18:8006057-8006079 GCTCCGACAAACCCTCACAAGGG - Intronic
1154522035 18:15240349-15240371 GATCTGAGTGTCCCTCACATAGG + Intergenic
1156329658 18:36107747-36107769 GGCCTCATTGACCCTCACATGGG + Intergenic
1156332196 18:36132835-36132857 GGTCAGAGAAACCCTCAGATTGG + Intronic
1165044752 19:33095830-33095852 GGTGTGACTGACCTTCACTTTGG + Intronic
1202651207 1_KI270707v1_random:5303-5325 GGTCTGATTGTTCCTCACATAGG + Intergenic
1202660980 1_KI270708v1_random:70927-70949 GGTCTGAATGTCCCTGACATAGG - Intergenic
1202661612 1_KI270708v1_random:76665-76687 GCTCTGAATATCCCTGACATAGG - Intergenic
1202661628 1_KI270708v1_random:76805-76827 GGTCTGAATGTCCCTCACATAGG - Intergenic
1202662427 1_KI270708v1_random:84125-84147 GGTCTGACTGTCCCTCACATAGG - Intergenic
938521403 2:132074081-132074103 GATCTGAGTGTCCCTCACATAGG + Intergenic
944695110 2:202193747-202193769 AATGTGAGTAACCCTCACATGGG - Intronic
944921778 2:204421608-204421630 TATTTGACTTACCCTCACATGGG - Intergenic
1175199576 20:57267942-57267964 GCTCTGGCTAAGCCTCACTTTGG + Intergenic
1176600917 21:8794191-8794213 GGTCTGATTGTTCCTCACATAGG - Intergenic
1176626706 21:9097521-9097543 GGTCTGAATGACCCTCACATAGG + Intergenic
1176626781 21:9098185-9098207 GGTCTGAATGTCCCTGACATAGG + Intergenic
1176774872 21:13122887-13122909 GGTCTGAATGTCCCACACATAGG - Intergenic
1176775410 21:13128236-13128258 GATCTGAGTGTCCCTCACATAGG - Intergenic
1176946262 21:14985703-14985725 GATCTTACTAACCTTGACATGGG - Intronic
1180328463 22:11454475-11454497 GGTCTGAATGTCCCTGACATAGG - Intergenic
1180329242 22:11461668-11461690 GGTCTGACTGTCCCTCACATAGG - Intergenic
1180343204 22:11685728-11685750 GGTCTGATTGTTCCTCACATAGG - Intergenic
1180417298 22:12779105-12779127 GGTCTGAATGTACCTCACATAGG + Intergenic
1180417421 22:12780202-12780224 GGTCTGATTGTTCCTCACATAGG + Intergenic
1180522701 22:16224629-16224651 GTTCTGACTGTCCCTCACAATGG - Intergenic
1180522958 22:16227200-16227222 GATCTGAGTGTCCCTCACATAGG - Intergenic
1180523511 22:16232414-16232436 GGTCTGAATGTCCCTCACATAGG - Intergenic
1184080036 22:42212921-42212943 GGTTTGACTAACCAAGACATTGG + Exonic
953217640 3:40936145-40936167 GGTCTGACAAAATCTCTCATAGG - Intergenic
957092810 3:75749007-75749029 GGTCTGCTTGTCCCTCACATAGG + Intronic
957093179 3:75752070-75752092 GGTCTGACTAACCCTCACATAGG + Intronic
957093239 3:75752537-75752559 GGTCTGAATGTCCCTCACATAGG + Intronic
957093291 3:75752964-75752986 GGTCTGAATGTCCCTCACATAGG + Intronic
960971391 3:123142523-123142545 GGTCTGACTAGACCCCACTTGGG - Intronic
973364374 4:49197084-49197106 GGTCTGATTGTTCCTCACATAGG - Intergenic
973396163 4:49594885-49594907 GGTCTGAATGTCCCTGACATAGG + Intergenic
973396483 4:49597698-49597720 GGTCTGAATGTCCCTGACATAGG + Intergenic
973396712 4:49599654-49599676 GGTCTGATTGTTCCTCACATAGG + Intergenic
975668718 4:76758536-76758558 CATCTGACCAACCCTCACAATGG - Intronic
1202761909 4_GL000008v2_random:119986-120008 GGTCTGAATGTCCCTGACATAGG - Intergenic
992021436 5:72628545-72628567 GTACTGAATAACCCTCCCATTGG - Intergenic
992411391 5:76509228-76509250 AGTCTGCCTAACACTCCCATTGG - Intronic
1002796343 6:474007-474029 TGTCAGAGTAGCCCTCACATAGG - Intergenic
1009503423 6:64445704-64445726 GGAGTGACTAGCCATCACATTGG - Intronic
1012796427 6:103768302-103768324 TATCTGACTAAGCATCACATGGG + Intergenic
1018329274 6:162710167-162710189 AGTCTGGTTAAGCCTCACATAGG + Intronic
1021044596 7:15906921-15906943 AGTCTGACTAAACCTCACTTTGG + Intergenic
1021810196 7:24395553-24395575 TGTCAGTCTTACCCTCACATTGG + Intergenic
1022709122 7:32834894-32834916 GCTCTGGGTAACCCTCACAGTGG + Intergenic
1032241414 7:130162203-130162225 GGGCAGACAAAGCCTCACATGGG + Intergenic
1035521089 8:275397-275419 AGTCTGCCAAACTCTCACATAGG + Intergenic
1041661816 8:60408309-60408331 GGTCTGAATAACATTCAAATTGG - Intergenic
1043383623 8:79728134-79728156 GGCCTCCCTGACCCTCACATAGG + Intergenic
1044737032 8:95289370-95289392 TGTCTGACTAACTGTCACAGGGG - Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1053700360 9:40683819-40683841 GTTCTGACTGTCCCTCACAATGG + Intergenic
1053700531 9:40685540-40685562 GGTCTGAATGTCCCGCACATAGG + Intergenic
1053718783 9:40923978-40924000 GGTCTGAATGTCCCTCACATAGG + Intergenic
1054311652 9:63483217-63483239 GTTCTGACTGTCCCTCACAATGG + Intergenic
1054311823 9:63484938-63484960 GGTCTGAATGTCCCGCACATAGG + Intergenic
1054410434 9:64807370-64807392 GTTCTGACTGTCCCTCACAATGG + Intergenic
1054410597 9:64808995-64809017 GGTCTGAATGTCCCGCACATAGG + Intergenic
1055911919 9:81363184-81363206 GGACTGACCAACCCTGCCATTGG + Intergenic
1061567682 9:131454463-131454485 GGTTAGACTAACCCTCCCACAGG - Intronic
1203455820 Un_GL000219v1:166497-166519 GGTCTGAATGTTCCTCACATAGG - Intergenic
1203484056 Un_GL000224v1:36032-36054 GGTCTGATTGTTCCTCACATAGG - Intergenic
1203497619 Un_GL000224v1:167214-167236 GGTCTGAATGCCCCTCACATAGG - Intergenic
1203497780 Un_GL000224v1:168788-168810 GTTCTGTTTCACCCTCACATAGG - Intergenic
1203510177 Un_KI270741v1:109270-109292 GGTCTGAATGCCCCTCACATAGG - Intergenic
1203510331 Un_KI270741v1:111038-111060 GTTCTGTTTCACCCTCACATAGG - Intergenic
1203542677 Un_KI270743v1:104867-104889 GGTCTGAATGTCCCTGACATAGG - Intergenic
1186316829 X:8379682-8379704 GTTATGAGTATCCCTCACATAGG + Intergenic
1190067193 X:47249386-47249408 GGGCTGAGTGACCCTCACAGTGG - Intergenic
1201163352 Y:11183956-11183978 GGTCTGAATGTCCCTGACATAGG + Intergenic
1201163568 Y:11185918-11185940 GGTCTGATTGTTCCTCACATAGG + Intergenic