ID: 957099771

View in Genome Browser
Species Human (GRCh38)
Location 3:75812278-75812300
Sequence GTTCTTAAGGGGAATGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957099771_957099777 -9 Left 957099771 3:75812278-75812300 CCCAACACATTCCCCTTAAGAAC No data
Right 957099777 3:75812292-75812314 CTTAAGAACAGGAATAAAATAGG No data
957099771_957099778 -8 Left 957099771 3:75812278-75812300 CCCAACACATTCCCCTTAAGAAC No data
Right 957099778 3:75812293-75812315 TTAAGAACAGGAATAAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957099771 Original CRISPR GTTCTTAAGGGGAATGTGTT GGG (reversed) Intergenic
No off target data available for this crispr