ID: 957110336

View in Genome Browser
Species Human (GRCh38)
Location 3:75947515-75947537
Sequence AGCCAGACAGTAAATATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1636
Summary {0: 1, 1: 9, 2: 53, 3: 306, 4: 1267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957110336_957110338 24 Left 957110336 3:75947515-75947537 CCTGCAATATTTACTGTCTGGCT 0: 1
1: 9
2: 53
3: 306
4: 1267
Right 957110338 3:75947562-75947584 CTGATCTAGATGAAACCCTGTGG 0: 2
1: 1
2: 1
3: 9
4: 117
957110336_957110340 26 Left 957110336 3:75947515-75947537 CCTGCAATATTTACTGTCTGGCT 0: 1
1: 9
2: 53
3: 306
4: 1267
Right 957110340 3:75947564-75947586 GATCTAGATGAAACCCTGTGGGG 0: 1
1: 2
2: 0
3: 9
4: 75
957110336_957110339 25 Left 957110336 3:75947515-75947537 CCTGCAATATTTACTGTCTGGCT 0: 1
1: 9
2: 53
3: 306
4: 1267
Right 957110339 3:75947563-75947585 TGATCTAGATGAAACCCTGTGGG 0: 1
1: 2
2: 1
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957110336 Original CRISPR AGCCAGACAGTAAATATTGC AGG (reversed) Intronic