ID: 957110338

View in Genome Browser
Species Human (GRCh38)
Location 3:75947562-75947584
Sequence CTGATCTAGATGAAACCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 2, 1: 1, 2: 1, 3: 9, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957110336_957110338 24 Left 957110336 3:75947515-75947537 CCTGCAATATTTACTGTCTGGCT 0: 1
1: 9
2: 53
3: 306
4: 1267
Right 957110338 3:75947562-75947584 CTGATCTAGATGAAACCCTGTGG 0: 2
1: 1
2: 1
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957110338 Original CRISPR CTGATCTAGATGAAACCCTG TGG Intronic