ID: 957110339

View in Genome Browser
Species Human (GRCh38)
Location 3:75947563-75947585
Sequence TGATCTAGATGAAACCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 2, 2: 1, 3: 14, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957110336_957110339 25 Left 957110336 3:75947515-75947537 CCTGCAATATTTACTGTCTGGCT 0: 1
1: 9
2: 53
3: 306
4: 1267
Right 957110339 3:75947563-75947585 TGATCTAGATGAAACCCTGTGGG 0: 1
1: 2
2: 1
3: 14
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957110339 Original CRISPR TGATCTAGATGAAACCCTGT GGG Intronic