ID: 957110339 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:75947563-75947585 |
Sequence | TGATCTAGATGAAACCCTGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 126 | |||
Summary | {0: 1, 1: 2, 2: 1, 3: 14, 4: 108} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
957110336_957110339 | 25 | Left | 957110336 | 3:75947515-75947537 | CCTGCAATATTTACTGTCTGGCT | 0: 1 1: 9 2: 53 3: 306 4: 1267 |
||
Right | 957110339 | 3:75947563-75947585 | TGATCTAGATGAAACCCTGTGGG | 0: 1 1: 2 2: 1 3: 14 4: 108 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
957110339 | Original CRISPR | TGATCTAGATGAAACCCTGT GGG | Intronic | ||