ID: 957110340

View in Genome Browser
Species Human (GRCh38)
Location 3:75947564-75947586
Sequence GATCTAGATGAAACCCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 2, 2: 0, 3: 9, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957110336_957110340 26 Left 957110336 3:75947515-75947537 CCTGCAATATTTACTGTCTGGCT 0: 1
1: 9
2: 53
3: 306
4: 1267
Right 957110340 3:75947564-75947586 GATCTAGATGAAACCCTGTGGGG 0: 1
1: 2
2: 0
3: 9
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957110340 Original CRISPR GATCTAGATGAAACCCTGTG GGG Intronic