ID: 957112780

View in Genome Browser
Species Human (GRCh38)
Location 3:75987291-75987313
Sequence CTTTTTGATGCTATAATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1356
Summary {0: 1, 1: 3, 2: 53, 3: 324, 4: 975}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957112779_957112780 8 Left 957112779 3:75987260-75987282 CCTGGCTAAGTTAATTACTAAGT 0: 1
1: 1
2: 1
3: 17
4: 179
Right 957112780 3:75987291-75987313 CTTTTTGATGCTATAATCAATGG 0: 1
1: 3
2: 53
3: 324
4: 975
957112778_957112780 9 Left 957112778 3:75987259-75987281 CCCTGGCTAAGTTAATTACTAAG 0: 1
1: 2
2: 26
3: 164
4: 782
Right 957112780 3:75987291-75987313 CTTTTTGATGCTATAATCAATGG 0: 1
1: 3
2: 53
3: 324
4: 975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957112780 Original CRISPR CTTTTTGATGCTATAATCAA TGG Intronic
900904726 1:5547008-5547030 CTTTTTGATGCTATTGTAAGCGG - Intergenic
900914425 1:5625170-5625192 ATTTTTGATGCTATTATATATGG - Intergenic
901289758 1:8114787-8114809 CTGTATGATACTATAATCAGTGG + Intergenic
902102828 1:14007081-14007103 CTCTTTGATGCTATCATGAATGG + Intergenic
902111951 1:14087216-14087238 AATTTTGATGCTATCATAAATGG + Intergenic
902265941 1:15264383-15264405 CTTTTTGATGCTATTGTAAATGG + Intronic
902300204 1:15496644-15496666 ATTTTTGATGCTATTGTCAATGG - Intronic
902563325 1:17292595-17292617 CTTTTTGATGCTCTTATAAATGG - Intergenic
903520735 1:23946504-23946526 CTTTTTGATGCTATTATAAATGG + Intergenic
903635809 1:24814639-24814661 CTTTCTAAAGCTATAATCCAAGG + Intronic
904099139 1:28007688-28007710 CTTTTTGATGCTATCACAAAAGG - Intronic
904103137 1:28051363-28051385 CCTTTTGATGCTATTGTGAATGG - Intronic
904315704 1:29659923-29659945 TTTTTTGATGCTATTGTAAATGG + Intergenic
904802847 1:33107730-33107752 TTTTTTGATGCAATTATAAATGG - Intronic
904929997 1:34079453-34079475 CTTTTTGATGCTATTGTGAATGG - Intronic
905135896 1:35799460-35799482 ATTTTTGATGCTATTGTAAATGG - Intergenic
905545505 1:38795819-38795841 CTTTTTTATGCTATTATAAATGG - Intergenic
905711933 1:40112393-40112415 CTTTTTGTGGCTATTATAAATGG - Intergenic
905712171 1:40114939-40114961 CTTTTTGATGCTATTGTAAATGG - Intergenic
906362866 1:45179054-45179076 CTTTTTCATGCTATCATAAATGG - Intronic
906995083 1:50784436-50784458 CTTTTTGAAGCTATTGTAAATGG - Intronic
907057485 1:51383982-51384004 CTTTTTGATGCTGTTGTAAATGG - Intronic
907067810 1:51503028-51503050 CTGTTTGATGCTATTGTGAATGG - Intronic
907070357 1:51528899-51528921 CTTTTTGATGTTATTGTAAACGG - Intergenic
907083447 1:51646363-51646385 CCTTTTGATGCTATTATAAATGG + Intronic
907144732 1:52221728-52221750 CTTTTTGTTAATATAAGCAAAGG - Intronic
907147642 1:52250365-52250387 CTTTTTGATGCTATTGTAAATGG + Intronic
907177966 1:52543327-52543349 CTTTTTGATGGTATTGTAAATGG - Intronic
907542327 1:55227178-55227200 CCTTTTGGTGCTATTATAAATGG + Intergenic
907966681 1:59337606-59337628 CTTTTTGATGCTATTGTGAATGG + Intronic
908011547 1:59783211-59783233 ATTTTTGAATCTATAATAAATGG + Intergenic
908056406 1:60291945-60291967 ATTTTTGTGGCTATAATCACAGG - Intergenic
908084423 1:60615441-60615463 TATTTTGATGCTATTATAAATGG + Intergenic
908131284 1:61078039-61078061 CGATTTGATCCTCTAATCAATGG + Intronic
908593775 1:65662759-65662781 CATTTTGTTGCTATTATAAATGG + Intergenic
908635982 1:66165633-66165655 CTTTTTGATGCTATTATAAAGGG - Intronic
908980095 1:69945742-69945764 ATTTTTTATGCTATGATAAATGG + Intronic
909064160 1:70913244-70913266 ATTTTTGATGCTATTATAAATGG + Intronic
909103053 1:71375128-71375150 ATTTTCTATGCCATAATCAAGGG + Intergenic
909171894 1:72306547-72306569 CTTTCGGATGCTATTATGAATGG + Intergenic
909582331 1:77251920-77251942 TTTTTTGTTGCTATTATAAATGG - Intergenic
909599453 1:77446660-77446682 TTCTTTGATGCTATCATAAATGG + Intronic
910033158 1:82756601-82756623 CATTTTGATGCTATAATTATTGG - Intergenic
910102635 1:83594778-83594800 CTTTTTGAAGTTATAATCACTGG + Intergenic
910354324 1:86338557-86338579 TTTTTTCATGCTAGTATCAATGG + Intergenic
910513428 1:88032606-88032628 CTTTTTGATGGTATTATAAATGG - Intergenic
910545987 1:88419888-88419910 ATTTTTGATGCTATCATAAACGG - Intergenic
910556767 1:88543130-88543152 CTTTATGGTTCTATAATGAATGG + Intergenic
910708230 1:90152546-90152568 TTTTTTGAAGCTATTATAAAAGG + Intergenic
910734617 1:90439249-90439271 CTCTGTGGTGATATAATCAAAGG + Intergenic
910750967 1:90630072-90630094 CTTTTTGATGCTATTGTAAATGG - Intergenic
910784340 1:90978482-90978504 CTTTTTCATGCTACAACAAAGGG + Intronic
911155495 1:94632817-94632839 CTTTTTGATGGTATTGTAAATGG + Intergenic
911155786 1:94635526-94635548 CTTTTTGATGGTATTGTAAATGG + Intergenic
912027611 1:105198261-105198283 CTTTTTGGTGCTATTAAAAATGG + Intergenic
912119240 1:106449750-106449772 CTTTTTGATGTTATTGTAAATGG + Intergenic
912342127 1:108927047-108927069 CTTTTTGATGCTATTTTAAATGG - Intronic
912805017 1:112749037-112749059 GTTTTTGATGATACAATGAATGG + Intergenic
912824011 1:112888844-112888866 CTTCTTGTTGCTCTAATCACTGG + Intergenic
912955250 1:114151221-114151243 CTTTCTCTTGCTATGATCAAAGG + Intronic
914226479 1:145723350-145723372 TTTTTGGTTGCTATAATGAATGG + Intronic
914449312 1:147776670-147776692 CTTTGTTGTGCTATAATGAAGGG + Intergenic
915183706 1:154085389-154085411 TTTTTTGATGCTATCATAATTGG - Intronic
915882796 1:159689790-159689812 CTTTATGATGTAATAATCCATGG - Intergenic
916015358 1:160744675-160744697 CATTTTGAAGCTATAATTTAAGG - Intronic
916393129 1:164354660-164354682 CTTTTTGATGCTATTGTAAATGG - Intergenic
916397674 1:164409664-164409686 TTTTTTGATGCTATAATAAATGG + Intergenic
916718424 1:167464029-167464051 CTTTTTGAGGCTGTCATTAAAGG - Intronic
917069283 1:171131932-171131954 CTTTTTGATGCTATTGTAAATGG - Intergenic
917107522 1:171507896-171507918 CTTTTTGATGCTCTAGTAAATGG + Intronic
917195351 1:172458448-172458470 ATTTTTGATGCTATTACAAATGG - Intronic
917260898 1:173167224-173167246 TTTTTTGATGCTATTATAAATGG + Intergenic
917833944 1:178925435-178925457 CTTTTTGATGCTTTAGTAAATGG - Intergenic
917917459 1:179717430-179717452 CTTTTTGATGCTATAATAAACGG + Intergenic
918129677 1:181615508-181615530 CATTTTGATGCTATCATAATTGG + Intronic
918508750 1:185286576-185286598 ATTTTTGATGCTATCATAAGTGG + Intronic
918673113 1:187245716-187245738 CTTTTTGACGTTATTGTCAATGG + Intergenic
918870428 1:189966498-189966520 TTGTTTGATGCTATTATGAATGG - Intergenic
919052024 1:192523299-192523321 CTTTCTGATGTTATATTCTAAGG + Intergenic
919187969 1:194179322-194179344 CTTTTTGATGCTATTGTAAATGG - Intergenic
919400116 1:197103728-197103750 CTTTTAGAGGCTATAATAAAAGG - Exonic
919704961 1:200667625-200667647 TTTTTTGATGCTATAATAGAAGG - Intronic
919975977 1:202612932-202612954 CTTTTTGATGTCATTATAAATGG + Intronic
920617683 1:207509687-207509709 CTTTTTGATTTTCTAATCATGGG - Intronic
920634066 1:207681698-207681720 CTTTTTGATTTTCTAATCATGGG - Intronic
920635044 1:207694085-207694107 CTCTATAATACTATAATCAAAGG + Intronic
920803882 1:209215012-209215034 ATTTTTGTTGCTATTATAAATGG + Intergenic
921235189 1:213119557-213119579 TTTTTTGATACAAGAATCAAAGG + Intronic
921511836 1:216041140-216041162 CTTTTTCATTCTGTATTCAAAGG - Intronic
921647887 1:217640468-217640490 CATTTTGATGCTATTAAAAATGG - Intronic
921930476 1:220750135-220750157 GATTTTGATGCTATAATTAAAGG + Intronic
922742967 1:228025737-228025759 CTTTTTGATGCTATTGTCAATGG + Intronic
922848172 1:228706693-228706715 CTTTTTGTTGCTATTGTAAATGG + Intergenic
922973744 1:229766042-229766064 CTGTTTGATGCTATTGTAAATGG + Intergenic
922994084 1:229942247-229942269 TTTTTTGATGGTGTGATCAATGG + Intergenic
923138920 1:231143640-231143662 ATTTTTGATGCTATAGTAAATGG - Intergenic
923646427 1:235825573-235825595 CTTTTTGATGCTATTATAAATGG - Intronic
924070215 1:240269787-240269809 TTTTTTGATGCTATTATAAATGG + Intronic
924737858 1:246775037-246775059 ATATTTGATGCAATTATCAATGG + Intergenic
924760722 1:246982872-246982894 ATATTTGATGCAATTATCAATGG + Intronic
924930465 1:248727249-248727271 CTTTTTGCAGCTATTATGAAAGG - Intronic
1063676880 10:8148413-8148435 CTTTGTGAAGCTTTAATCACTGG - Intergenic
1063956114 10:11268963-11268985 CATTTTTAAGCTATAATCATTGG + Intronic
1064956723 10:20919409-20919431 CTTTATGTTTCTATAATCATGGG + Intronic
1065074932 10:22068056-22068078 CTTTTTGATGCTATTGTAGACGG + Intergenic
1065273254 10:24058636-24058658 CTTTTGGATGCTATTGTAAATGG + Intronic
1065543574 10:26795641-26795663 TTTTTGGATGCTATCATAAATGG - Intronic
1065704031 10:28454521-28454543 ATTTTTGATGCTATTGTAAATGG + Intergenic
1065807033 10:29403568-29403590 CTTTGTGATGCTACTATAAATGG - Intergenic
1066016503 10:31250161-31250183 GTTTTTCATGCTATTATAAATGG + Intergenic
1066025286 10:31351524-31351546 AATTTTGGTGCTATAATAAAAGG - Intronic
1066142057 10:32514674-32514696 CTCTTTGGTGCTATTATAAATGG - Intronic
1066181514 10:32966146-32966168 CTTTTTGATGCTATTGCAAATGG - Intronic
1066249870 10:33622798-33622820 CTTTTTGATGTAATAATTATAGG - Intergenic
1066427465 10:35321155-35321177 GTTTTTGATACTATAGTAAATGG - Intronic
1066691959 10:38038101-38038123 CTTTTTGATGCTATTGTATATGG + Intronic
1067000751 10:42610563-42610585 CTTTTTGATGCTATTGTAAATGG - Intronic
1067356693 10:45535029-45535051 TTTTTTGTTGTTATTATCAATGG - Intronic
1067422484 10:46166624-46166646 CTTTTAGATACTATCATAAATGG + Intergenic
1067997841 10:51295378-51295400 CTTTTTGTTACTATTATGAATGG + Intronic
1068061628 10:52075169-52075191 GTTTTTGATGCTATCATAAGTGG - Intronic
1068147652 10:53091647-53091669 CTTTTTAATCATAAAATCAATGG - Intergenic
1068347797 10:55806305-55806327 CTTTTAGATACTATCATAAATGG - Intergenic
1068454884 10:57241386-57241408 ATTTTTGATGCTATTATTAATGG - Intergenic
1068619880 10:59170364-59170386 CTTTTTGATGCTATTGTAAATGG + Intergenic
1068979648 10:63048616-63048638 CTTTTTGATTCTATTGTAAATGG - Intergenic
1069289052 10:66753768-66753790 CTATTTGATGCTATTGTAAATGG - Intronic
1069408878 10:68131793-68131815 TTTTTTAATGCTATTATTAATGG + Intronic
1069535755 10:69251726-69251748 CTTTTTGATGCTATTATAAATGG + Intronic
1069541972 10:69301611-69301633 CTTTTTGATGCTATTATACATGG - Intronic
1069852064 10:71413907-71413929 CTTTTTGATGCTATTGTAAATGG + Intronic
1070212646 10:74342382-74342404 CTTTTTGATGCTATTGTAAGTGG + Intronic
1070245481 10:74727708-74727730 ATTTTTGATGCTATTACAAATGG - Intergenic
1070293729 10:75140981-75141003 ATTTTTTATGCTATTATAAATGG + Intronic
1070377415 10:75846759-75846781 CTTTTTGATGCTATTATAAATGG - Intronic
1070443763 10:76473735-76473757 TCTTTTGATGCTATTATAAATGG - Intronic
1070460464 10:76663580-76663602 CTTTTTGATGTTATTGTAAATGG - Intergenic
1070666231 10:78346404-78346426 CTTTTTGATGCTATTGCAAATGG + Intergenic
1070859949 10:79646380-79646402 CTTTTAGATACTATCATAAATGG + Intergenic
1070937389 10:80311100-80311122 CTTTTCGATGCTATTATAAATGG - Intergenic
1071022499 10:81074440-81074462 GTTTTTGATGCTATTGTAAATGG + Intergenic
1071582339 10:86783866-86783888 CATTTTGATGTTATTATAAATGG + Intronic
1071604290 10:86973983-86974005 CTTTCTGATGTTAGAATCATAGG - Intronic
1072070827 10:91915188-91915210 CTTTTTCATCCTATCATAAATGG + Intergenic
1072878413 10:99200028-99200050 CTCTTTGATGCTATTGTAAATGG + Intronic
1073365084 10:102933371-102933393 TTTTTTGATGCTATTATAAATGG + Intronic
1073486978 10:103825447-103825469 CTTTTTGATGCTAATAAAAATGG + Intronic
1073505295 10:103982071-103982093 CTCTTTGATGCTATCGTAAATGG + Intronic
1073633150 10:105169121-105169143 CTTTTTGATGCCATTATAAGTGG - Intronic
1073699706 10:105912695-105912717 CTTTTTGATGCTATTGCAAATGG - Intergenic
1074004558 10:109406969-109406991 CTTTTTGATACTATTGTAAATGG - Intergenic
1074474820 10:113761526-113761548 CTTTTGGATGCTATTGTAAATGG + Intronic
1074620286 10:115112029-115112051 TTTTTTGATGCTATTGTAAATGG - Intronic
1074641658 10:115390895-115390917 ATTTTTTATGCTATCATGAATGG + Intronic
1074805906 10:117052169-117052191 CCTTTTGATGCTATTATAAAAGG - Intronic
1074955973 10:118389976-118389998 CTTTTAGATGCTATCGTAAATGG + Intergenic
1075538372 10:123290991-123291013 CTTTTTGATGCTATTATAGCTGG - Intergenic
1075848039 10:125562723-125562745 CTGTTTGATCTTTTAATCAAAGG + Intergenic
1076760361 10:132602197-132602219 CTTTTCGATGCTGTTATAAATGG + Intronic
1076770591 10:132661426-132661448 ATTTTTGATGCTATTATAAATGG - Intronic
1077212714 11:1380158-1380180 CCTTTTGATGCTATTTTAAATGG - Intergenic
1077436819 11:2544592-2544614 ATTTTTTATGCTATGGTCAATGG + Intronic
1077448358 11:2615144-2615166 CTTTTTGATGCTATTGTAAGTGG + Intronic
1077448607 11:2618924-2618946 TTTTTTGATGCTATCATAAATGG + Intronic
1077731328 11:4733422-4733444 CTTTTTGATGCTATTGTAAATGG + Intronic
1078195002 11:9129437-9129459 CATTTTGATGCTATGATAAATGG + Intronic
1078332241 11:10433813-10433835 CTTTTTGATGCTACTGTAAATGG - Intronic
1078632955 11:13020515-13020537 CTGTTTGATGTTATAGTAAATGG + Intergenic
1078696634 11:13639490-13639512 TTTTTTGATGCCATTATAAATGG + Intergenic
1079119218 11:17668615-17668637 CTTTTTGGTGCTATTGTAAATGG - Intergenic
1079119299 11:17670032-17670054 ATTTTTGATGCTATTATAAATGG + Intergenic
1080734134 11:34993983-34994005 TTTTTTGATACTATTATAAATGG + Intronic
1081035466 11:38138962-38138984 CTTTTTGAGGCTATTATAAGTGG - Intergenic
1081133809 11:39412857-39412879 CTGTTTGATGCTATGATGATGGG + Intergenic
1081233101 11:40610764-40610786 ATTTTTAATGCTATTATAAATGG - Intronic
1081404946 11:42687356-42687378 CTTTTTCATGCTATTGTAAATGG - Intergenic
1081791094 11:45785832-45785854 CTTTTTGATGCTATTGTAAATGG + Intergenic
1082276921 11:50232200-50232222 ATTTTTGGTGCTATTGTCAATGG + Intergenic
1082635940 11:55593828-55593850 ATTTTTGATGCTATACTAAATGG + Intergenic
1082733961 11:56835798-56835820 TTTTTTGATGCTATTTTAAATGG + Intergenic
1082753036 11:57042791-57042813 CTTTTTGATGCCATTGTAAATGG - Intergenic
1083030405 11:59586318-59586340 CTTTTTGATACTATTATAAGTGG - Intronic
1083085570 11:60140570-60140592 CTGTTTTATGCTATTATAAATGG - Intergenic
1083479588 11:62935090-62935112 TTTTTTGATGCTATTGTAAATGG + Intergenic
1084135086 11:67172517-67172539 TTTTTTTATGCTATTATAAATGG + Intronic
1084566796 11:69934039-69934061 CTTTTTGCTGCTATTACAAATGG - Intergenic
1084843807 11:71882987-71883009 CTTTTTCTTGCTATTATGAATGG - Intronic
1084853533 11:71964258-71964280 CTTTTTGATGCCATTGTTAATGG + Intronic
1084886688 11:72214092-72214114 CTTTTTGATGCTATTATGAATGG - Intergenic
1085766151 11:79283945-79283967 CTTTTTGATGCTATTATAAATGG - Intronic
1086033846 11:82393006-82393028 CTTCTTGCTGCTATAAGAAATGG - Intergenic
1086285228 11:85241143-85241165 TTTTTTGATGCTATAATAAATGG + Intronic
1086430748 11:86733944-86733966 CTTTTTGATGCTGCTATAAATGG - Intergenic
1086539713 11:87894165-87894187 CTGTTTGATGCTATCGTAAATGG + Intergenic
1086733588 11:90279235-90279257 CTTTTTGATGCTATTGTAAATGG + Intergenic
1086797354 11:91123844-91123866 ATTTTTGATGCTATTATAAATGG + Intergenic
1086852732 11:91829771-91829793 TTTTTTGATGCTATTGTAAATGG - Intergenic
1086877698 11:92116736-92116758 ATTTTTGAGGCTATCATAAAAGG - Intergenic
1087339566 11:96886193-96886215 CTTTCTGAAGCTATAAATAATGG + Intergenic
1087378446 11:97373492-97373514 CTTTTTGATGCTATTTTAAATGG - Intergenic
1087501407 11:98959281-98959303 ATTTTTGATTCTATAAGCACAGG - Intergenic
1087559609 11:99770693-99770715 TTTTTTGATGCTATTGTAAATGG + Intronic
1087578420 11:100020812-100020834 CTTTTTGATGCTATTGTAAATGG - Intronic
1088185351 11:107160903-107160925 GTTTTTGATGCTATTGTAAATGG - Intergenic
1088296258 11:108298927-108298949 CTTTTAGATGCTATCGTAAATGG - Intronic
1088337725 11:108726449-108726471 TTTTTTAATGCTATCATAAATGG + Intronic
1088829899 11:113527973-113527995 CTTTTTGTTATTATAAACAATGG - Intergenic
1088965060 11:114711510-114711532 CTTTTTGGTGCTGTAAGAAATGG - Intergenic
1089371774 11:117965501-117965523 TTTTTTGATGCTATTATAAATGG - Intergenic
1089547390 11:119239366-119239388 CATTTTGATGCTATTGTAAATGG + Intronic
1089825672 11:121274092-121274114 CTTTGTGATGCTATTATATATGG - Intergenic
1090494948 11:127202459-127202481 CATTTTGGTGCTATCATAAATGG - Intergenic
1090722245 11:129486544-129486566 TTTTTGGATGCTATTATAAATGG + Intergenic
1090789575 11:130079509-130079531 CTTTTTTATGCTATTATAAATGG + Intronic
1090894425 11:130957771-130957793 ATTTTTGATGCCATTATAAATGG + Intergenic
1091176637 11:133564188-133564210 TTTTTTGATGCTTTAAAAAATGG - Intergenic
1091412182 12:250530-250552 ATTTTTGATGCTATTGTAAATGG - Intronic
1091700514 12:2656331-2656353 TTTTTTGATGCTATTGTAAAAGG - Intronic
1091707632 12:2709252-2709274 CTTTTTGATGCTACTGTAAATGG - Intergenic
1092085380 12:5753643-5753665 CTTTTTGGTGCTATTGTGAATGG + Intronic
1092439676 12:8488389-8488411 CTTTTTGATGCTACTGTAAATGG - Intergenic
1092494031 12:8973810-8973832 CTTTTTCTTGCTATTATAAATGG + Intronic
1092535929 12:9387176-9387198 CTTTTGGATGCTATTGTGAATGG + Intergenic
1092827225 12:12412369-12412391 CTTTTTGATGCTATTGGAAATGG + Intronic
1093009784 12:14094369-14094391 CTCTTTGATGCTATTGTAAATGG - Intergenic
1093260155 12:16926012-16926034 TTTTTTGATGCTATTGTAAATGG + Intergenic
1093339617 12:17956388-17956410 ATTTTTGATGCTATCTTAAATGG - Intergenic
1093659672 12:21739917-21739939 CTTTTTGATGCCATTACAAATGG + Intronic
1093738552 12:22653601-22653623 CTTTTCGATGCTATCGTAAATGG + Intronic
1093796458 12:23318926-23318948 CTTTTTGATGCTATTATAAATGG - Intergenic
1093909403 12:24728694-24728716 CTTTTTGATGCTGTAGCCATTGG + Intergenic
1093917961 12:24826886-24826908 CTTTTTGTGGCTATTATAAATGG + Intronic
1093944745 12:25094825-25094847 CATTTTGATGCTATTGTAAAGGG + Intronic
1094081892 12:26545734-26545756 CTTTTTGAATCTATCATCCAAGG + Intronic
1094311599 12:29090043-29090065 CTTTTTGATGCTATTGTAAATGG - Intergenic
1094457029 12:30646714-30646736 CTTTTTGACGCTATTGTAAATGG - Intronic
1094574896 12:31676085-31676107 CTTTTTGATGGTAACATAAATGG - Intronic
1095582612 12:43817373-43817395 CTTTTCAATCATATAATCAAGGG - Intergenic
1095620263 12:44245446-44245468 ATTTTTGATGCTATTGTAAATGG + Intronic
1095646118 12:44549658-44549680 CTTTTTGATGCTATTGTAAATGG - Intronic
1095765939 12:45895840-45895862 CTTTTTGATGCTATTGTAAATGG - Intronic
1095880092 12:47125752-47125774 TATTTTGATGCTATTATAAAGGG + Intronic
1095881639 12:47143474-47143496 ATTTTTGATGCTATTATAAATGG - Intronic
1096293973 12:50367833-50367855 ATTTTTGATGCTATTATAAATGG - Intronic
1096325065 12:50652864-50652886 CTTTTTGATGTTATTATAAATGG + Intronic
1096762860 12:53857486-53857508 ATTTTTGATGGTATTATAAATGG - Intergenic
1097132964 12:56826886-56826908 CTTCTTGATGCTATTGTAAATGG + Intergenic
1097206861 12:57329916-57329938 GTTTTTGATGCTATTGTAAATGG + Intronic
1097367790 12:58739222-58739244 ATTTTTGATGCTATTGTAAAAGG - Intronic
1097570300 12:61323942-61323964 CTTCTTGATGCTATTATAAGTGG + Intergenic
1097594066 12:61606028-61606050 TTTTTTGATGCTATCATATATGG + Intergenic
1097660860 12:62429532-62429554 CTTTTTGATACTATTATAAGTGG - Intergenic
1097933735 12:65221257-65221279 CTTTCTAATGCTATTATAAATGG + Intronic
1098106916 12:67077443-67077465 CTTTTTGCTGTTATAAATAAAGG - Intergenic
1098125253 12:67285114-67285136 CTTTCTGTTGCTATAATAAATGG - Intronic
1098576948 12:72053349-72053371 GTTTTTGGAGCTATAAGCAATGG + Intronic
1098660708 12:73089583-73089605 GTTTTTGATGCTATTGTAAATGG - Intergenic
1098766177 12:74492147-74492169 CTTTGTTATGCTATAATCTGAGG - Intergenic
1098870075 12:75807540-75807562 CTTTTGGATGCTATTGTAAATGG + Intergenic
1098962956 12:76758154-76758176 CTTTTTGATGCTACTATAAATGG - Intergenic
1099026645 12:77472661-77472683 GTTTTTGATGCTATTGTGAATGG - Intergenic
1099232739 12:80046398-80046420 CTTCTTGATGTTACTATCAATGG - Intergenic
1099551779 12:84054715-84054737 CTTTTTGATGCTATTGTTAATGG + Intergenic
1099617545 12:84956901-84956923 CTTTTTGATGCAATATTCAATGG + Intergenic
1099774350 12:87104837-87104859 CTTTTTCATCCTAATATCAATGG + Intergenic
1099850951 12:88096796-88096818 CTTTTTTATGCTAGATTAAAAGG - Intronic
1100413722 12:94349898-94349920 CTTTTTGATGCTATTGTAAATGG - Intronic
1100627456 12:96350012-96350034 GTTTTTGATGCTATTCTAAATGG - Intronic
1101121814 12:101589465-101589487 CTCTTGGATGCTATAGTAAATGG - Intronic
1101354393 12:103963700-103963722 ATTTTTGATGCTATTGTGAATGG + Intronic
1101704116 12:107204654-107204676 CTTTTTGATGCTATTGAGAATGG + Intergenic
1101945874 12:109136588-109136610 CTTTTGAATGCTATTATAAATGG + Intronic
1102069710 12:110007773-110007795 TTTTTTGATGCTATTATAGATGG + Intronic
1103584827 12:121944629-121944651 TTTTTTGATGCTATTATAAATGG + Intronic
1104240114 12:126980183-126980205 CTTTCTTGTGCTCTAATCAAAGG + Intergenic
1104263739 12:127211041-127211063 CTTTTTGCTGAAATAAGCAATGG - Intergenic
1104740793 12:131171789-131171811 CCTTTAGATGCTATTATGAATGG - Intergenic
1104800292 12:131550648-131550670 CTTTTTGATGCTATTATAAATGG + Intergenic
1105311042 13:19211448-19211470 CTGTATGATACTATAATCATAGG + Intergenic
1105361267 13:19719018-19719040 CTGTATGATGCTATAATCATAGG + Intronic
1105515613 13:21087630-21087652 ATTTTTGATGCTATTGTAAATGG - Intergenic
1105616319 13:22016847-22016869 TATTTTGATGCTATCATAAAAGG - Intergenic
1105637948 13:22234032-22234054 CTCTTTGTGGCTATAATAAACGG - Intergenic
1105832869 13:24180725-24180747 CTTTCTGATGCTATTATAGATGG + Intronic
1106299064 13:28446542-28446564 CTTTTTGATGCTGTTATAAATGG - Intronic
1106333186 13:28758719-28758741 CTTTTTGATGCTATTGTAAATGG + Intergenic
1106341571 13:28833914-28833936 CTTTTTGATACTATTACAAATGG - Intronic
1106623922 13:31399275-31399297 ATTTTTTATGCTATCATAAATGG + Intergenic
1106634753 13:31516289-31516311 ATTTTTGTTGCTATAGTAAATGG + Intergenic
1106646969 13:31646639-31646661 CTTTATGATGCTATTACAAATGG - Intergenic
1106711797 13:32343926-32343948 CTTTTTGATGCTTTATTACAGGG - Intronic
1106755314 13:32817125-32817147 CTTTTTAATGTTATTATGAATGG - Intergenic
1107048746 13:36024473-36024495 CTTTTTGATGCTATTGTGAATGG - Intronic
1107361988 13:39628500-39628522 CTTTTTGATGTTATTGTAAATGG + Intergenic
1107552518 13:41490273-41490295 TTTTTTGATGCTATTTTAAATGG + Intergenic
1107705484 13:43099139-43099161 CTTTTTAATGCTATTGTGAATGG + Intronic
1108136040 13:47361924-47361946 ATTTTTGATGCTATTGTGAAAGG - Intergenic
1108260681 13:48652641-48652663 CATTTTGATGCTATTATAAATGG + Intergenic
1108681747 13:52786679-52786701 GTTTTTGATGCCATAGTCTATGG + Intergenic
1109204984 13:59472811-59472833 CTCTTTGATGCTTTTATAAATGG - Intergenic
1109971538 13:69776903-69776925 CTTTTTAATTCAATAATAAAAGG + Intronic
1110027308 13:70556995-70557017 CTTTTTGATGGCATTATAAATGG - Intergenic
1110047717 13:70851680-70851702 ATTTTTGATACTATTATAAATGG - Intergenic
1110210126 13:72962295-72962317 CTTTTTGATGCTATTGTACATGG - Intronic
1110564902 13:76948077-76948099 ATTTTTGATCTTATAAGCAAGGG + Intergenic
1110720632 13:78757594-78757616 CTTTTTGAAGCATCAATCAATGG - Intergenic
1110977137 13:81852959-81852981 CTTTTTGATGCCATCGTAAATGG - Intergenic
1111010573 13:82308718-82308740 CTTTTTGTAGCTATTATAAAAGG + Intergenic
1111166735 13:84467619-84467641 CTTTTCGATGCTATTGTAAATGG - Intergenic
1111193239 13:84836638-84836660 CTTTTTGATTTTATTATAAATGG - Intergenic
1111379371 13:87426651-87426673 GTTTTTGTTGTGATAATCAATGG + Intergenic
1111567140 13:90030651-90030673 CTTTTTGATGCTGTTGTAAATGG - Intergenic
1111792822 13:92880227-92880249 CTTTTTGATTCTATTGTAAATGG - Intergenic
1111890587 13:94077229-94077251 TTTTTTGATGCTATTGTTAATGG + Intronic
1112049007 13:95626763-95626785 CTTTGGGATGCTATTATAAATGG - Intronic
1112564249 13:100538968-100538990 CTTTTTGATGCTATCATAAATGG + Intronic
1112947043 13:104941882-104941904 CATTTTGCTTCTTTAATCAATGG + Intergenic
1112970662 13:105258220-105258242 ATTTTTGGTGGTATAATTAATGG - Intergenic
1113141182 13:107151528-107151550 GTTTTTGATGCTATTGTAAATGG + Intergenic
1113227284 13:108173165-108173187 CTTTTTGTGGCTATCATAAATGG - Intergenic
1113363984 13:109659152-109659174 GTTTTTGATGCTATCATAAATGG - Intergenic
1114051853 14:18926509-18926531 TGTTTTGATGCTATTATAAACGG - Intergenic
1114110706 14:19475412-19475434 TGTTTTGATGCTATTATAAACGG + Intergenic
1114180223 14:20360394-20360416 CTTTCTGACGCTATTATAAATGG - Intergenic
1114357815 14:21932204-21932226 CTTTTTGATGCTATTGCAAATGG + Intergenic
1114357943 14:21934808-21934830 ATTTTTGATGCTATTGTAAATGG - Intergenic
1114593178 14:23887973-23887995 GTTTTCGATGCTATTATAAATGG - Intergenic
1114923643 14:27365337-27365359 ATTTTTGATGCTATTGTAAATGG + Intergenic
1115150615 14:30280762-30280784 TTTTTTGATGCCATTATAAATGG + Intergenic
1115211805 14:30974319-30974341 CTTTTTGATGCTATTGTGAATGG - Intronic
1115419575 14:33178571-33178593 CTTTTAGATGCTGTTATAAATGG + Intronic
1115657142 14:35454242-35454264 TTTTTTGATGCTATCATAAATGG + Intergenic
1115724895 14:36202679-36202701 CTGTTTGATGTTATTATAAATGG - Intergenic
1116004012 14:39272897-39272919 CTTTTTGATGCTATTATAGATGG + Intronic
1116016165 14:39409812-39409834 CTTTTTGATGTTACTGTCAATGG + Intronic
1116342768 14:43746301-43746323 CTTTTTGAGGCTTTAAACTATGG - Intergenic
1116842729 14:49835882-49835904 CTTTTTGATGCTATTGTCAGTGG - Intronic
1117059168 14:51943695-51943717 CTTTTTGATGCTACTGTTAATGG - Intronic
1117295549 14:54375983-54376005 TTTTTTAATGCTATAAAAAAAGG + Intergenic
1117477615 14:56112659-56112681 CTTTTTGATGCTATTGTAAATGG - Intergenic
1117586830 14:57216059-57216081 CTTTTTCATGCTATTGTAAATGG - Intronic
1117762532 14:59045775-59045797 CTTTTTGATGGTATTACAAATGG + Intergenic
1117864485 14:60131454-60131476 CTTTTTGATGCTATTTTAAGTGG - Intronic
1118313849 14:64712567-64712589 CTTTTTGCTGCTATTATAAATGG + Intronic
1118430037 14:65708585-65708607 TTTTTTGATGCTATTGTAAATGG + Intronic
1118491137 14:66261689-66261711 CTTTTTGGTGCTATCATAAATGG + Intergenic
1118551363 14:66954378-66954400 CTCTTTGATGCTATTGTAAATGG + Intronic
1118557094 14:67036679-67036701 CTTTCTGATGCTATTGTAAATGG - Intronic
1118969936 14:70627007-70627029 GTTTTTGATGTTATTATAAATGG - Intergenic
1119089598 14:71769108-71769130 CTTTTTGATGCTATGATAAATGG - Intergenic
1119106122 14:71925904-71925926 CTTTTTGATGCTATCATAAATGG - Intergenic
1119255193 14:73189690-73189712 TTTTTTGCTGCTATCATAAATGG - Intronic
1119367771 14:74109700-74109722 CTTTTTGATGCTATTATAAATGG + Intronic
1119493352 14:75057243-75057265 CTTTTTGATGCTATTATAAATGG - Intronic
1119562184 14:75599355-75599377 TTTTTTAATGCTATTATAAATGG - Intronic
1119873924 14:78040701-78040723 TTTTTTGATGCTATTGTAAATGG + Intergenic
1120136953 14:80880999-80881021 TTTTTTAATGCTATCATAAATGG - Intronic
1120274911 14:82360615-82360637 AGTTTTGATTATATAATCAAAGG + Intergenic
1120660707 14:87247397-87247419 TTTTTTGTAGCTATTATCAATGG + Intergenic
1121074204 14:91053583-91053605 TTTTTTGATGCTATAGTAAAAGG - Intronic
1121316844 14:92966352-92966374 CTTTTTGATGCTTTTATAAATGG - Intronic
1121500696 14:94434649-94434671 CTATTTGATGCTGAAGTCAATGG + Intergenic
1122240039 14:100357817-100357839 CTTTTTAATGCTATTCTAAATGG - Intronic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1123439260 15:20278763-20278785 CTTTTTGATGCTATTGTGAATGG - Intergenic
1124052007 15:26205456-26205478 CTTTTTGATGTTCAAATCCAGGG - Intergenic
1124056824 15:26248383-26248405 CTTTTTAATGCTGTTATAAATGG + Intergenic
1124123801 15:26916820-26916842 CTTTTTGATGCTATAATAAGTGG + Intronic
1124128380 15:26961086-26961108 CTTTTTGATACTATTTTAAATGG - Intergenic
1124237094 15:27999859-27999881 CTTTTTGATGCTATTATAGATGG - Intronic
1124243159 15:28048011-28048033 CTTTTGGATGCTATTGTAAATGG - Intronic
1124378707 15:29146051-29146073 CTTCTTGATGCTATCATAAATGG - Intronic
1124475632 15:30031881-30031903 CTTTTTGATTCTATTAGAAATGG + Intergenic
1124508537 15:30301741-30301763 GTTTTTGATGCTATTGTAAATGG + Intergenic
1124703935 15:31944827-31944849 TTTTTTGATGCTATTGTAAATGG - Intergenic
1124735020 15:32236920-32236942 ATTTTTGATGCTATTGTAAATGG - Intergenic
1124931985 15:34129302-34129324 CTTTTTGGTGTTATTATAAATGG + Intergenic
1125369638 15:38959032-38959054 CTCTTTGATGCTATGGTAAATGG - Intergenic
1125890611 15:43263115-43263137 CTTTTTGATGCTGTTATAAATGG - Intronic
1126160853 15:45612084-45612106 ATTTTAAATGTTATAATCAAAGG - Intronic
1126200919 15:45985047-45985069 CTTTTTGATGCTATTGTAAATGG + Intergenic
1126207803 15:46065691-46065713 ATTTTTGATGCTATTTTAAATGG - Intergenic
1126303981 15:47233665-47233687 CTTTTTGATACTATTGTAAATGG + Intronic
1126535973 15:49764756-49764778 CTTATTGATGCTATTTTAAATGG + Intergenic
1127050125 15:55073838-55073860 ATTTTTGATGCTATTTTAAATGG - Intergenic
1127116082 15:55728985-55729007 CTTTTAGATGCTATTGTAAATGG - Intronic
1127158982 15:56160503-56160525 GTTTTTGAAGCTTAAATCAAGGG - Intronic
1127427680 15:58872246-58872268 TTGTTTGATGCTATTATAAATGG - Intronic
1127730214 15:61794015-61794037 TTTTTTGATGCCATTATAAATGG + Intergenic
1127929734 15:63585454-63585476 CTTTTTGATGCTACTATAAATGG + Intronic
1128070763 15:64795381-64795403 CTTTTTGATGCTATTGTAAATGG + Intergenic
1128627135 15:69221486-69221508 CTTTTTGATGCTATAATAAATGG + Intronic
1128696506 15:69768113-69768135 CTTTTTGATGCTATTGTAAATGG + Intergenic
1128837507 15:70822221-70822243 CTTTTTGGAGCTATTATAAATGG + Intergenic
1128954812 15:71928689-71928711 TTTTTTGATGCTATTGTAAATGG + Intronic
1129012546 15:72435528-72435550 CTTTTTGATGCTATTGTAAATGG + Intergenic
1129097978 15:73229313-73229335 CTTTTTGATGCTATTGTGAGTGG + Intronic
1129492322 15:75940234-75940256 CTTTTTGACGCTATGGTAAATGG - Exonic
1130571642 15:85051056-85051078 CTTTTTGATGCTATTGTAATTGG + Intronic
1130792924 15:87175214-87175236 ATTTTTGATGCTATTGTGAATGG - Intergenic
1130857227 15:87851183-87851205 CTTTGTGAGGCTCTCATCAAAGG - Intergenic
1131091289 15:89626565-89626587 CCTTCTGCTGCTAGAATCAAAGG + Intronic
1131114564 15:89786150-89786172 CTTGTTGATGCTATCGTAAATGG - Intronic
1131630414 15:94170444-94170466 CTTTTTGATGGTATTGTAAAAGG - Intergenic
1131754202 15:95542672-95542694 CTTTTTGATTCTATGATTATAGG + Intergenic
1131895465 15:97023873-97023895 ATTTTTGATGCTAATATAAATGG - Intergenic
1132160129 15:99533423-99533445 TTTTTTGATGCTATTGTAAATGG - Intergenic
1132522079 16:396253-396275 CTTTTTGCTGCTATTGTGAATGG - Intergenic
1133885840 16:9826903-9826925 CTTTTTGTTGCTATGTTCAAAGG - Intronic
1134088668 16:11376917-11376939 CTTTTTGATGCTATTGTAAATGG + Intronic
1134437431 16:14274057-14274079 ATTTTTGATGCTATTATAAATGG - Intergenic
1135516054 16:23135575-23135597 CTTGTTGATGCTATTGTAAATGG - Intronic
1136097863 16:27971396-27971418 ATTTTTGATGCTATTATGAATGG + Intronic
1136507786 16:30716742-30716764 CTTTTTGATGGGCTTATCAAGGG + Intronic
1136845913 16:33575617-33575639 CTTTTTGATGCTATTGTGAATGG + Intergenic
1136994037 16:35175756-35175778 CTTTTTGAAGTTTTAATAAATGG - Intergenic
1137261987 16:46838484-46838506 CTTTTTGATGATATTATAAATGG - Intergenic
1137353740 16:47737840-47737862 CTTTTTCATGCTATTGTAAATGG + Intergenic
1137358462 16:47790107-47790129 TTTTTTGATGCTATCATAAATGG + Intergenic
1137795905 16:51219497-51219519 GTTTTTGATGCTACTATAAATGG - Intergenic
1137880585 16:52042777-52042799 CTTTTTGATGCTATCATAAATGG + Intronic
1138005705 16:53334848-53334870 TTTTTTGAGCCTATACTCAAGGG - Intergenic
1138109843 16:54314960-54314982 TATTTTGCTGCTATAAACAATGG + Intergenic
1138254779 16:55546173-55546195 TTTTTTGGTGCTATAGTCGAAGG - Intronic
1138485262 16:57337863-57337885 CTTTTTGATGCTATTGTAAATGG + Intergenic
1138557047 16:57777092-57777114 CTTTTTGATGCTATTGTAAATGG - Intronic
1138996324 16:62457639-62457661 ATTTTTAATGCTATCATAAATGG + Intergenic
1139022979 16:62775440-62775462 ATTTTTGATGCTATTGTAAATGG + Intergenic
1139140152 16:64252372-64252394 CTTTTTGACTCTATTATAAATGG + Intergenic
1139496297 16:67321316-67321338 ATTTTTGATGCTATTGTAAATGG - Intronic
1140171074 16:72605669-72605691 CTTTTTGATGGTATTGTAAATGG - Intergenic
1140492357 16:75348832-75348854 CTTTTTGATGCTTTTGTAAATGG + Intronic
1140654774 16:77128655-77128677 CTTTTTGATGCTATTGTAAATGG - Intergenic
1142327653 16:89427160-89427182 CTTTTTGATGCTGTTTTAAATGG - Intronic
1142437260 16:90068755-90068777 CTTTTTGATGCTATTGTGATTGG - Intronic
1203107621 16_KI270728v1_random:1424270-1424292 CTTTTTGATGCTATTGTGAATGG + Intergenic
1143738571 17:8934315-8934337 CTTTTTGATGCTATTATGAATGG - Intronic
1143822007 17:9572343-9572365 CTTTGTGTTGCTAAAATCATAGG - Intronic
1144449786 17:15367070-15367092 CTTTTGGATGCTATCATAAATGG - Intergenic
1145723549 17:27095249-27095271 TGTTTTGATGCTATTATAAATGG - Intergenic
1145820317 17:27828599-27828621 CTTTTTGGTGCTATTGTAAATGG - Intronic
1146230637 17:31105215-31105237 CTTTTTGATGATATAGTCAGTGG - Intronic
1146510360 17:33442511-33442533 CTTTTTGATGACATCATAAATGG + Intronic
1146523888 17:33549442-33549464 CTTTTCAAAGCTATAATCATGGG + Intronic
1146600385 17:34209652-34209674 CTTTTTGGTACTATTATAAATGG + Intergenic
1148286090 17:46393531-46393553 CTTTCTGATGTTATTATAAATGG - Intergenic
1148308257 17:46611121-46611143 CTTTCTGATGTTATTATAAATGG - Intronic
1148673326 17:49429337-49429359 CATTTTGATGCTATTATAAGTGG - Intronic
1149041170 17:52190338-52190360 CTTTTTAATGCTATCGTAAATGG + Intergenic
1149041859 17:52199401-52199423 CTTTTTTATGCTATTGTAAATGG - Intergenic
1150663116 17:67103484-67103506 CTTTCTCATGCTATCATAAATGG - Intronic
1150907486 17:69353575-69353597 CTAATTGGTGCTATAATCATTGG + Intergenic
1151031110 17:70740414-70740436 GTTGTTGATGCTAGAATCTACGG + Intergenic
1151446352 17:74167358-74167380 TTTTTTGATGCTATTAAAAATGG - Intergenic
1152397420 17:80042430-80042452 ATTTTTGATGCCATTATAAATGG + Intronic
1152411940 17:80130140-80130162 CTTTTTGATGCAATTGTAAATGG + Intergenic
1152975080 18:207828-207850 CTTTTTGATGCTTTTGTAAATGG + Intronic
1153259050 18:3204466-3204488 CTCTTTGATGCTATTGTGAATGG - Intronic
1153385814 18:4494167-4494189 CTTTATGATACTGTAATCATGGG - Intergenic
1153540900 18:6153463-6153485 CTTTTTGATGCTATTGTAAATGG + Intronic
1153558589 18:6345566-6345588 CTTTTTGATGTTATTGTTAAGGG - Intronic
1153657433 18:7295873-7295895 CCTTTTGATGCTATGGTAAATGG + Intergenic
1153873861 18:9347583-9347605 CTTTTTGATGCTATTGTTAGTGG + Intronic
1154003089 18:10501835-10501857 CTTTTTAATGCTATTGTAAATGG + Intergenic
1154093795 18:11391076-11391098 ATATTTGATTCTATAATAAAAGG + Intergenic
1154224561 18:12491071-12491093 CTTTTTGGTGCTGTTGTCAATGG - Intronic
1154282813 18:13021853-13021875 CTTTTAGATGCTATTGTAAATGG + Intronic
1154393709 18:13967593-13967615 CTTTTTAATGATATTATGAATGG - Intergenic
1154413695 18:14160213-14160235 CTTTTTGATGCTATCATAAGTGG - Intergenic
1154982230 18:21512423-21512445 CTTTTTGATGCTATTGTAAATGG + Intronic
1154984013 18:21531126-21531148 TTTTTTGATGTTATTATAAATGG - Intronic
1155180949 18:23345904-23345926 CTTTTTGATGCTATTGTGAATGG + Intronic
1155260370 18:24036467-24036489 CTTTTTGGTGCTATTGTAAATGG + Intronic
1155472028 18:26201711-26201733 TTTTTTTATGCTATTATAAATGG - Intergenic
1155583191 18:27335500-27335522 CTTTTTGTAGCTATTATAAATGG + Intergenic
1155630948 18:27891534-27891556 CGTTTTGATGCTATCATAAATGG + Intergenic
1155690213 18:28611938-28611960 ATTTTTGATGCTATTTTAAATGG - Intergenic
1155808280 18:30200025-30200047 ATTTTTGTTGCTATTATAAATGG - Intergenic
1155886500 18:31215227-31215249 CTCTTTGATGCTATCATAAATGG - Intergenic
1155896557 18:31336267-31336289 GTTTTTTTTGCTATTATCAAAGG + Intronic
1156028267 18:32682537-32682559 CTTTTTAATGTGATCATCAAAGG + Intronic
1156288913 18:35727765-35727787 CTTTTTGTTGCTATTATAAATGG - Intergenic
1156293333 18:35769226-35769248 TTTTTTGATGCTATCATAAATGG + Intergenic
1156691887 18:39717477-39717499 CTTTTTGATGATATTGTAAATGG + Intergenic
1156738174 18:40289613-40289635 CTTTTTGATGCTATCATAAATGG - Intergenic
1156827806 18:41453355-41453377 CTTTTTGATGCTACTGTAAATGG - Intergenic
1157417468 18:47517192-47517214 CTTTTTGATGCTATTGCAAATGG - Intergenic
1157708490 18:49830281-49830303 CTTTTTGATGTTATTGTAAATGG - Intronic
1157787516 18:50498447-50498469 CTTTTTGATGCTATTGTAATAGG + Intergenic
1158149012 18:54345272-54345294 CTTTTTGATGTTATTGTAAATGG - Intronic
1158844362 18:61425964-61425986 CTTTTTGATGCTATTACAAATGG + Intronic
1159395545 18:67850891-67850913 CTTTTTGTTGCTATTGTGAATGG - Intergenic
1159427366 18:68307321-68307343 TTTTTTAAGGCTATAATAAAGGG - Intergenic
1159560660 18:69989635-69989657 ATTTTTGATGCTATTGTAAATGG - Intergenic
1159821114 18:73145229-73145251 CTTTTTGATGCTGTTATAGAAGG + Intergenic
1160470043 18:79123306-79123328 CTTTTTGATGAGATTATAAATGG - Intronic
1160545075 18:79647667-79647689 ATTTTTGATGCTATTGTAAATGG - Intergenic
1160547667 18:79671572-79671594 CTTTTTGGTGCTATTATAAACGG + Intergenic
1160576858 18:79860530-79860552 CTTTCTGATGCTCTTATAAATGG + Intergenic
1160589285 18:79933628-79933650 CTTTTTGATGCTATTGTAAATGG - Intronic
1163473298 19:17510596-17510618 CTTTATGATGCTATGGTAAATGG + Intergenic
1164150799 19:22548797-22548819 CTTTTTGATGCGATTGTAAATGG - Intergenic
1164946590 19:32299002-32299024 CTTTTTGATGCTGTCATAAAAGG + Intergenic
1165035220 19:33028510-33028532 CTTTTTGATGCTATTGTGAATGG - Intronic
1165142451 19:33708978-33709000 CTTTTTGATGCTACAGTGAATGG + Intronic
1165536955 19:36456150-36456172 CTTTTTGATGTTATTATACATGG - Intronic
1165597044 19:37018050-37018072 CTTTTTGATGCTATTGTGAATGG - Intronic
1166012153 19:39950445-39950467 ATTTTGGCTGCTATAATCATAGG - Intergenic
1166398685 19:42461820-42461842 CTATTTTTTTCTATAATCAAAGG + Intergenic
1166973274 19:46585781-46585803 CTTTTTGATGCTATTACGAATGG - Intronic
1167407433 19:49322312-49322334 CTTTCTGATGCTATTACAAATGG - Intronic
1167724838 19:51203727-51203749 CCTTTTGATGGTATTATAAATGG - Intergenic
924997001 2:370731-370753 CTTTTTGAGGCTATCATAAATGG + Intergenic
925206285 2:2009449-2009471 TTTTTTGATGCTATCATAAATGG + Intronic
925321920 2:2977327-2977349 CTTTTTGATGCTATTATGAATGG - Intergenic
925354721 2:3231097-3231119 CTTTTTGATGCTGTTGTAAATGG + Intronic
925598216 2:5579174-5579196 CTTTTTGATGCTATTGTACATGG - Intergenic
925839962 2:7981868-7981890 TTTTTTGATGCTATCTTCAATGG - Intergenic
925960263 2:9007483-9007505 TTTTTTAATGTTAAAATCAAAGG + Intergenic
926262289 2:11276419-11276441 CTTTTTGATGTTATTGTAAATGG - Intronic
926377456 2:12247807-12247829 CGTATTGTTGCTATAATAAAAGG + Intergenic
926552130 2:14313609-14313631 CTTTTTGATGCAAAAATGTAGGG - Intergenic
926816538 2:16803569-16803591 CTTTTTGATGCTACTGTAAACGG + Intergenic
926966384 2:18418040-18418062 CTTTTTGATGCTTTTGTAAATGG - Intergenic
927008258 2:18874554-18874576 ATTTTTGATGCTATGGTAAATGG - Intergenic
927396671 2:22659640-22659662 ATTTTTGATGCTATTATTAATGG + Intergenic
927544051 2:23937641-23937663 CTTTTTGATGCTATTGTAAAAGG - Intronic
927798854 2:26078078-26078100 CTTTTTGATGCTACTGTAAATGG - Intronic
927839144 2:26427013-26427035 CTTTTTGGTGCTATAGTAAATGG + Intronic
928059141 2:28092465-28092487 CTTTTTGATGCTATTTTAAATGG - Intronic
928068369 2:28189529-28189551 ATTTTTGATGCTATTTTAAATGG - Intronic
928119305 2:28571207-28571229 ATTTTTGATGCTATTGTAAATGG - Intronic
928184703 2:29099937-29099959 CTTTTTGATGCTAATGTAAATGG + Intronic
928587895 2:32780402-32780424 CTTTTTCATACTATTATAAATGG + Intronic
928851151 2:35748649-35748671 CTTTTTGATACTATTACAAATGG - Intergenic
928916317 2:36475338-36475360 CTTTTTGATGCTATTGTGATTGG + Intronic
928937596 2:36695608-36695630 CTTTTTAATGCTATAAAACATGG - Intergenic
929387407 2:41425833-41425855 CTTTTTGTTGCTATTGTGAATGG + Intergenic
929498830 2:42472322-42472344 TTTTATAATGGTATAATCAATGG - Intronic
929736537 2:44555873-44555895 CTCTTTGTTGCTAAATTCAATGG - Intronic
930212459 2:48655239-48655261 GTTTTTGGTGCTATTATAAATGG + Intronic
930496509 2:52151620-52151642 CTTTTTGATACTATTGTAAATGG - Intergenic
930524745 2:52514063-52514085 CTTTTTGATACTATTATAAATGG - Intergenic
930593772 2:53360572-53360594 ATTTTTGATGCTATTATAAATGG + Intergenic
930737919 2:54798542-54798564 TTTTTTGATGCTATTATAAGTGG + Intronic
931192124 2:60013636-60013658 CTTTTTGATGCCATTGTAAATGG - Intergenic
931224105 2:60314558-60314580 TTTTTTGTTGCTATCATTAAAGG + Intergenic
931479651 2:62628328-62628350 CTTTTTGATGCTATTATAAATGG + Intergenic
931567950 2:63636101-63636123 TTTTTTGATGCTATTGTAAATGG - Intronic
931824986 2:65991021-65991043 CTTTTTTATACTAAAATCTATGG - Intergenic
931989297 2:67773675-67773697 CTTAATGATGCCATAATCTAGGG + Intergenic
932069425 2:68602881-68602903 CTTTTTGATGCTATTGTAAATGG - Intronic
932342074 2:70969861-70969883 CTTTTTGATGCCATTGTAAATGG + Intronic
932382197 2:71294905-71294927 CTTTTTGATGCTATTACAAATGG + Intronic
932637419 2:73403777-73403799 TTTTTTGATGCTATCATAAGTGG + Intronic
932905323 2:75743355-75743377 TTTTTTGTTGCTATTATAAATGG - Intergenic
933361213 2:81287498-81287520 CTTTTTGATGCTATTGTGCATGG + Intergenic
933512539 2:83259288-83259310 CTTTTTGTTGCTATTGTGAATGG - Intergenic
934911408 2:98258585-98258607 CTTTTGGGTGCTATTATAAATGG + Intronic
934931349 2:98427557-98427579 GTTTTTGATGCTATTCTAAACGG + Intergenic
935382754 2:102469173-102469195 TTTTTTGATGCTATTATAAATGG + Intergenic
935582561 2:104770195-104770217 CTTTCTGATGCTATTGTAAATGG - Intergenic
935683314 2:105658000-105658022 CTATTTGGTGCTATTATAAATGG - Intergenic
935953937 2:108355722-108355744 CTTTTCAATGCTATAATAAATGG + Intergenic
936268102 2:111026570-111026592 ATTTTTGATGCTATTGTAAATGG + Intronic
936395687 2:112127010-112127032 CTTTTTGATGCTATTGTAAATGG - Intergenic
936990429 2:118358780-118358802 CTTTTTGATGCTACTGTAAATGG + Intergenic
937020887 2:118653764-118653786 CTTTTGGATGCTATTGTAAATGG - Intergenic
937180277 2:119989518-119989540 CTTTTTGATGCTATTGTAAATGG - Intergenic
937566799 2:123302549-123302571 CTGTTTAATGCTATTATAAATGG - Intergenic
937666414 2:124492723-124492745 ATTTTTGATGCTATTGTAAATGG + Intronic
937834334 2:126456876-126456898 TTCTTTGATGCTATTATAAATGG + Intergenic
938129636 2:128702587-128702609 CACTTTGATGCTATTATAAAGGG + Intergenic
938147195 2:128845902-128845924 CTTTTTGATGCTATTACAAATGG + Intergenic
938190106 2:129271313-129271335 TATTTTGATGCTATTATAAATGG - Intergenic
938234522 2:129694592-129694614 CTTTTTGATACTATTGTAAATGG - Intergenic
938371923 2:130775251-130775273 CTTTTTAACGCTATTATAAATGG - Intergenic
938389810 2:130896163-130896185 CTTTTTGATTTTTTAATCTAAGG + Intronic
938394577 2:130933676-130933698 CTTTTTGATGACATCATAAATGG + Intronic
938548327 2:132354902-132354924 TTCTTTGATGCTATTATAAATGG + Intergenic
938549063 2:132362925-132362947 CTTCTTAATGCTATTTTCAATGG + Intergenic
938553957 2:132406870-132406892 CTTTTTGATGCTACTATAAATGG + Intergenic
938815116 2:134894972-134894994 CTTGCTGATGCTATTATAAATGG - Intronic
938952993 2:136273705-136273727 CTTTTTGATACTATTGTCAATGG - Intergenic
939379721 2:141418958-141418980 ATTTTTAATGCTATTATAAATGG + Intronic
939834771 2:147115697-147115719 ATTTTTGATGCTACTATCAATGG + Intergenic
940091254 2:149921057-149921079 CTTTTTGATGCTATTGTAAATGG - Intergenic
940315545 2:152324248-152324270 ATTTTTGATGCTACCATAAATGG + Intergenic
940598221 2:155821640-155821662 GTTTTTGAAGCTATAATACATGG - Intergenic
940671939 2:156680818-156680840 TTTTTTCATGCTATAGTAAATGG + Intergenic
940819829 2:158340568-158340590 TTTTTTGATCCTATATTTAAAGG - Intronic
940920491 2:159300371-159300393 CTTTTTGATAATATTACCAATGG + Intergenic
941738468 2:169006797-169006819 ATTTTTGATGTTATCATAAATGG - Intronic
941742082 2:169045863-169045885 CTTTTTGATGCTGTTATAAATGG - Intergenic
942160412 2:173179864-173179886 CTTTTTGATGCTACTGTAAATGG - Intronic
942437416 2:175995461-175995483 CTATTCAAGGCTATAATCAAAGG + Intronic
942814892 2:180041363-180041385 TATTTTGATGCTATTATGAATGG + Intergenic
943074984 2:183183466-183183488 TTTTTTGATGCTCTTATAAATGG + Intergenic
943218910 2:185078347-185078369 ATTTTTCATGCTATCATAAATGG - Intergenic
943229949 2:185236825-185236847 CTTTTTCATGCTATTGTAAATGG - Intergenic
943294746 2:186123115-186123137 CTTTTTGTTGCTATTATGAATGG - Intergenic
943911816 2:193578804-193578826 CTTTTTGATGCTATTGTAAATGG - Intergenic
944073355 2:195697961-195697983 CTTTTTGATGCTATTGTAAGTGG + Intronic
944347056 2:198681693-198681715 CTTTTTGATGCTTTTGTAAATGG - Intergenic
944386969 2:199177595-199177617 TTTTTTGATACTATTATAAATGG - Intergenic
944432571 2:199649678-199649700 TGTTTTGATGCTATTATAAATGG + Intergenic
944471680 2:200060046-200060068 CTTTTTGTGGCTATTATGAATGG - Intergenic
944484253 2:200187670-200187692 CTTTTTGATGCTATTGTAAGTGG - Intergenic
944722566 2:202439211-202439233 TCTTTTGATGCTATTATGAATGG + Intronic
944974166 2:205028921-205028943 CTTTTTGATGCTATTGTAAATGG - Intronic
945103974 2:206290596-206290618 CTTTTTGATGCTATTGTAAATGG + Intronic
945385718 2:209198269-209198291 CCTTTTGATGCTATTATAAATGG - Intergenic
945403002 2:209410469-209410491 CTTTTTGATGCTATAGTAAAAGG - Intergenic
945635427 2:212343405-212343427 CATTTTGATGCTAAAATGATAGG + Intronic
945690504 2:213028615-213028637 TTTTGGGATGTTATAATCAATGG + Intronic
945954996 2:216078304-216078326 TTTTTTTATGCCAGAATCAATGG - Intronic
946184161 2:217968521-217968543 CTTTTTGATGCTGTTTTAAATGG - Intronic
946469268 2:219941439-219941461 CTTTTTGATGCTATTGTAAATGG + Intergenic
946695311 2:222351545-222351567 ATTTTTGATGTTATTATAAATGG + Intergenic
946755175 2:222937176-222937198 CTTTTTGATGCTACATTAAATGG + Intronic
946815433 2:223572849-223572871 CTTTTTGATGCTATTGTAAATGG - Intergenic
947358425 2:229321152-229321174 CATTTAGAAGCTAAAATCAATGG - Intergenic
947458347 2:230279067-230279089 CTTTTTGTTGCTATTGTAAATGG - Intronic
947468450 2:230376475-230376497 CTTTTTGTTGCTATTGTAAATGG - Intronic
948851150 2:240706879-240706901 TTTTTTAATGCTATTATAAAAGG + Intergenic
948885624 2:240881783-240881805 CTTGTTGATGCTGTTATAAATGG + Intergenic
1168867591 20:1101552-1101574 CTTTTTAGTGCTATTATAAATGG + Intergenic
1168909143 20:1432351-1432373 CTTTTGGATGCTGTTATAAATGG + Intergenic
1168999427 20:2156593-2156615 CTTTTTGATGATATTTTAAATGG - Intronic
1169031556 20:2412772-2412794 CTTTTTGATGCTATTGTAAATGG - Intronic
1169043095 20:2512061-2512083 CTTTTTGATGCTATTGCAAATGG - Intronic
1169238752 20:3955878-3955900 CTTTTGGATGCTATTGTAAATGG + Intronic
1169322698 20:4646779-4646801 CTTTTTGATGCTACTATAAATGG - Intergenic
1169408028 20:5341787-5341809 CTTTTTGATGCTATTGTAAATGG - Intergenic
1169533448 20:6510479-6510501 CTTTTTGATGCTATCATATATGG + Intergenic
1169963488 20:11189267-11189289 CTTTTTGCTTCTAAAATTAAAGG - Intergenic
1170175354 20:13462767-13462789 CTTTTTAATGCTATTGTAAATGG - Intronic
1170178946 20:13507158-13507180 CTTTTTGATGCTATTATAAATGG - Intronic
1170183801 20:13564327-13564349 CTTTTCGATGCTATTGTAAATGG - Intronic
1170221405 20:13946380-13946402 CTTTTTTATGCTATTTTAAATGG - Intronic
1170260025 20:14394359-14394381 ATTTTTGATGCTATGGTAAATGG + Intronic
1170582924 20:17712310-17712332 CTTTTTGCTGCAAAAACCAAGGG + Intronic
1170966730 20:21079727-21079749 GTTTTTGATACTATTATAAATGG - Intergenic
1171176681 20:23055925-23055947 CTTTTTGATGCTATTATAAATGG - Intergenic
1171251903 20:23655243-23655265 CTTTTTAATGATATGATCAGTGG + Intergenic
1171350245 20:24496471-24496493 CTTTTTGATTCTAAAAGCATGGG + Intronic
1171877199 20:30587679-30587701 TTCTTTGATGCTATTATAAATGG + Intergenic
1172058539 20:32172339-32172361 ATTTTTGATGCTATTGTAAATGG + Intergenic
1172294853 20:33801936-33801958 ATTTTTGATGCTATTGTAAATGG + Intergenic
1172378383 20:34465660-34465682 CTTTGTGATGCTATTGTAAATGG + Intronic
1173547809 20:43912876-43912898 TTTTTTGTTGCTATTATGAATGG - Intergenic
1173693866 20:44990288-44990310 CTTTTTGATACTATTTTAAATGG + Intronic
1173717997 20:45227644-45227666 CTTTTCGATGCTATTGTAAATGG + Intergenic
1173770835 20:45655824-45655846 CTTTTTGAAGCTATTGTGAATGG - Intronic
1173776366 20:45710754-45710776 CTTTTTGATGCTATTGTAAATGG - Intergenic
1174341220 20:49897221-49897243 CTTTTTGATGCTATTATAAATGG - Intergenic
1174892474 20:54411328-54411350 TTTTTTGATGCTATTGTAAATGG - Intergenic
1174967647 20:55236310-55236332 TTTTCTGATGCTATTATAAATGG + Intergenic
1175170673 20:57078628-57078650 CTTTTTGATACTATTGTAAATGG + Intergenic
1175654585 20:60758675-60758697 CTTTCTGATGTTATCATAAATGG - Intergenic
1175982751 20:62748198-62748220 CTTTTTGATGCTATTGTAAATGG - Intronic
1176859325 21:13998042-13998064 CTTTCTGATGCTATCATAAGTGG + Intergenic
1176898432 21:14411346-14411368 CTTTTTGTGGCTATCATGAATGG + Intergenic
1176900111 21:14430704-14430726 CTTTTTGATTCTATAGTAAAAGG - Intergenic
1176977279 21:15336175-15336197 CTTTATGATGCTATTATAAATGG - Intergenic
1177408136 21:20697239-20697261 CCCTTTGATGCTATTATAAATGG - Intergenic
1177519290 21:22196830-22196852 ATTTTTGATGCTATGGTAAATGG + Intergenic
1177679399 21:24345741-24345763 CTTTTTGATGCTATACAAAATGG + Intergenic
1177795508 21:25774672-25774694 ATTTTTGGTGCCAAAATCAAAGG + Intergenic
1178374282 21:32054099-32054121 ATATTTGATCCTATCATCAATGG + Intergenic
1178962469 21:37078530-37078552 GTTTTTGTTGCTATTATAAATGG + Intronic
1179024776 21:37670934-37670956 TTTTTGGATGCTATTGTCAATGG + Intronic
1179806626 21:43842535-43842557 CTTTGTGATGCTATTGTGAACGG + Intergenic
1180249740 21:46575649-46575671 TTTTTTGATGCTATTGTCAATGG - Intergenic
1180470326 22:15648888-15648910 TGTTTTGATGCTATTATAAATGG - Intergenic
1180572417 22:16739612-16739634 CATTTTGTTACTATAATCCAGGG + Intergenic
1180856063 22:19046266-19046288 TTTTTTGGTGCTATTATTAATGG + Intronic
1180895023 22:19324589-19324611 CTTTTTGATGCTATTGTAAGTGG - Intergenic
1181600025 22:23945488-23945510 CTTTTTGATGCCATTATAAATGG - Intergenic
1181608479 22:23995831-23995853 CTTTTTGATGGTATTATAAATGG + Intergenic
1181641579 22:24203146-24203168 CTTTTTTATGCTATTGTGAAAGG + Intergenic
1181663881 22:24376456-24376478 CTTTTTGATGCTGCTATAAATGG - Intronic
1181795773 22:25308819-25308841 CTTTATGATGCTATTGTGAATGG + Intergenic
1181836311 22:25612353-25612375 CTTTTTGATGCTATTGTGAATGG + Intronic
1182384446 22:29924805-29924827 CTTTTTTATGCTATTGTAAATGG + Intronic
1182916054 22:34031954-34031976 ATTTTTGATGCTATCATTAATGG + Intergenic
1182934085 22:34204403-34204425 CTTTTTGATGCTATCATAAGTGG - Intergenic
1183766720 22:39883883-39883905 CTTTTTGAAGCTCTAGTAAATGG - Intronic
1184051600 22:42010053-42010075 CTTTTTGATGCTATTGTAAATGG + Intronic
1184315036 22:43680697-43680719 CTTTTTGATGCTATTGTAAATGG + Intronic
1184345619 22:43910781-43910803 CATTTAGGTTCTATAATCAAGGG + Intergenic
1184505617 22:44899746-44899768 CTTTTTGCTGCAATCATAAATGG + Intronic
1184635802 22:45829619-45829641 ATTTTTGATGCTATTATAAAAGG - Intronic
1184811712 22:46839231-46839253 CTTTTTGATTCTATTGTAAATGG - Intronic
1185412412 22:50690850-50690872 CTTCTGGATGCTATTATAAATGG + Intergenic
949446339 3:4138053-4138075 TTTTTTGATGCTATTATAAATGG - Intronic
949705820 3:6815328-6815350 CCTTTTTATGCTAAAATCATGGG - Intronic
949756626 3:7418802-7418824 CTTTTTGATTCCAAAACCAATGG - Intronic
949893535 3:8752094-8752116 CTTTCTGATGGTATTATAAATGG + Exonic
950321216 3:12055716-12055738 TCTTTTGATGCTATTATAAATGG + Intronic
950699202 3:14728448-14728470 CTTTTTGGTGGGATATTCAATGG - Exonic
950759068 3:15204441-15204463 ATTTTTGATGCTATTGTAAATGG - Intergenic
951565295 3:24007002-24007024 ATTTTTGTTGCTGTAATGAATGG + Intergenic
951678624 3:25271102-25271124 CATTTTGATGCTAAAATTAGAGG - Intronic
951716553 3:25654327-25654349 CTTTTTGATGCTATAGTAAATGG - Intronic
951733890 3:25841660-25841682 ATTTTTTATGCTATGATAAATGG - Intergenic
951966672 3:28394165-28394187 CTTTTTGATGCTATTGTAAATGG - Intronic
951971360 3:28448328-28448350 CTTTTTGATGCCATTGTAAATGG - Intronic
952010790 3:28898723-28898745 CTTTTTGAAGCTGTTGTCAATGG + Intergenic
952310865 3:32188721-32188743 CTTTTTGATACTATTATAAATGG + Intergenic
952415625 3:33088532-33088554 CTTTTTGATGCTTTTATATATGG - Intronic
952563278 3:34621572-34621594 CTTTTGGATGCTATTGTAAATGG + Intergenic
952692195 3:36222262-36222284 GTTTTTGATGCTATGATAAATGG + Intergenic
952735330 3:36684991-36685013 CTTTTTGATGCTGTTGTAAATGG - Intergenic
953163368 3:40442749-40442771 CTTTTTCATAATTTAATCAATGG - Intergenic
953283816 3:41584896-41584918 CTTTTTGATGCTATTGTAAATGG - Intronic
953329552 3:42041362-42041384 CCTTTTGATGTTATTATAAATGG + Intronic
953509461 3:43520902-43520924 CTTTTTGATGCTACAATAAATGG + Intronic
953812583 3:46126919-46126941 CTTTTTGATGCTATTGTAGATGG - Intergenic
953900812 3:46842054-46842076 CTTTTTGATGCTATTGTAAATGG - Intergenic
953988529 3:47465009-47465031 CTTTTTGATGCTATTATAAATGG - Intronic
953997647 3:47532527-47532549 CTTTTTGATGCTATTGTAAATGG + Intergenic
954370877 3:50169059-50169081 CTTTGTGGGGCTATAACCAAGGG + Intronic
954503896 3:51049952-51049974 CTTTTTGATGCTATTGTAAATGG - Intronic
954521297 3:51228926-51228948 CTTCTTGATGCCATAATAATGGG + Intronic
954522817 3:51244434-51244456 CTTTTTGATGCTATTGTAAATGG + Intronic
954557237 3:51527617-51527639 CTTTTTGATGCTATTGCAAATGG + Intergenic
954591171 3:51783734-51783756 CTTTTTGATGCTATTACAAATGG + Intergenic
955546029 3:60031363-60031385 CTTTGCAATGCTATAGTCAAAGG - Intronic
955572459 3:60322798-60322820 CTTTGTAATGTGATAATCAAGGG - Intronic
955599179 3:60626459-60626481 CTTTTTGATGCCCTCATAAATGG + Intronic
955849114 3:63200763-63200785 CTTTGTGATACTATCATGAAAGG + Intergenic
956318703 3:67970011-67970033 CTTTTTGATACTATCATAAATGG - Intergenic
957112780 3:75987291-75987313 CTTTTTGATGCTATAATCAATGG + Intronic
957174029 3:76781164-76781186 CCTTTTGATGATATTATAAATGG + Intronic
957284422 3:78199598-78199620 CTTTTTGATTCTATTATAAATGG - Intergenic
957628755 3:82690752-82690774 CTTTTTGCTGCTCTAATCCGTGG + Intergenic
957639024 3:82826272-82826294 CATTTTGATGCTATTGTAAATGG + Intergenic
957768138 3:84653252-84653274 CTTTTTGCTGCTATGGTGAATGG - Intergenic
958590133 3:96146713-96146735 CTTTTTGTTGCTATGATAAATGG + Intergenic
958763533 3:98337523-98337545 CTTTTATATGCTATTATGAATGG - Intergenic
958770438 3:98419693-98419715 CTTTTTGAAGCTATTGTAAATGG - Intergenic
958810057 3:98850870-98850892 TTTTTTGATGCTATTATGGATGG - Intronic
959229894 3:103634429-103634451 CTTCTTGATGCTATTGTGAATGG - Intergenic
959492319 3:107005187-107005209 CTTAATGCTGCTATAATGAATGG - Intergenic
959521044 3:107323290-107323312 CTTTATGAAGCTAAATTCAATGG + Intergenic
959561323 3:107786071-107786093 CTTTTTGATGCTATTGTAAATGG - Intronic
959654486 3:108785964-108785986 TTTTCTGATGCTATTATAAATGG + Intergenic
959782461 3:110252009-110252031 TTTTTTGATGCTATTATAAATGG + Intergenic
959794527 3:110408800-110408822 CTTTTTGATGCTTTTACTAATGG + Intergenic
959826351 3:110801521-110801543 TTTTTTGATGCTGTCATAAATGG + Intergenic
959977524 3:112478376-112478398 CATTTTGATGCTATTGTAAATGG + Intronic
960631890 3:119740741-119740763 CTGTGTGATGATAAAATCAAGGG - Intronic
960690069 3:120337305-120337327 CTATTTGATGGTATAAAAAATGG + Intronic
960804578 3:121571405-121571427 ATTTTTGATGCTATTGTAAATGG - Intronic
960886010 3:122395453-122395475 CTTTTTGATGCTATTATAAATGG - Intronic
960889816 3:122435846-122435868 CTTTATGATGCAATCATCACAGG - Intronic
961113740 3:124310157-124310179 CTTTTTTATGCTATTATAAATGG - Intronic
961251259 3:125507964-125507986 CTTTTTGATGCTATTGTAAATGG - Intronic
961317068 3:126046498-126046520 CCTTTTGATGCTATTATAAATGG - Intronic
961409701 3:126710678-126710700 ATTTTTGATGCTATTGTGAATGG + Intronic
961430466 3:126878830-126878852 CTGCCTGATGCTATTATCAAAGG - Intronic
961956812 3:130812913-130812935 CTTTTTGGTGCTATTGTTAATGG - Intergenic
962288831 3:134112587-134112609 CTTTTTGATGCCATTGTAAATGG - Intronic
962300387 3:134236346-134236368 CTTTTGGATGCTATTGTAAATGG - Intronic
962700519 3:137994472-137994494 CTTTTTGATGCTATTACAAACGG + Intergenic
962707140 3:138054810-138054832 CTTTTTGATGTTATTATAAGTGG - Intergenic
962838474 3:139211428-139211450 CTTTTTGGTGCTATTATAAATGG + Intronic
963179983 3:142344643-142344665 CTTTTTCATGCTTTTTTCAATGG - Intronic
963276415 3:143335188-143335210 CTTTATGATGCTATTGTAAATGG - Intronic
963291023 3:143489128-143489150 ATTTTTGATGCTATTGTGAATGG - Intronic
963363556 3:144305880-144305902 TTATTTGATGCTATTATAAATGG + Intergenic
963464002 3:145654483-145654505 CTTTATGACACTATAATCATGGG + Intergenic
963805790 3:149720868-149720890 ATTTTTGATGCTATTATAAATGG + Intronic
963824885 3:149942441-149942463 CTTTTTGTTGCTATAGTAAATGG + Intronic
963891758 3:150643858-150643880 GTTTTTGATGCTATTGTAAATGG - Intergenic
964033303 3:152165180-152165202 CTTCTTGCTGCTAAAATGAAAGG + Intergenic
964349557 3:155789367-155789389 CTTTGTGATGTTATTATAAATGG - Intronic
964645593 3:158955802-158955824 CTAATTGTTTCTATAATCAAGGG - Intergenic
965050210 3:163636794-163636816 CTTTTTGATGATATTGTAAATGG + Intergenic
965447174 3:168789271-168789293 CTTTTTGATGCTGTGGTAAATGG - Intergenic
966008274 3:175044114-175044136 CTTTTTGATGCTATTGTAAATGG + Intronic
966501991 3:180652897-180652919 CTTTTTGATGCCATTGTAAATGG - Intronic
966579871 3:181548760-181548782 CTTTTAGATGCTATTTTAAATGG + Intergenic
966997970 3:185302583-185302605 CTTTTTGATGCTATTATAAATGG + Intronic
967039840 3:185681327-185681349 CTTTTTGATGCTATTGTAAGTGG - Intronic
967577670 3:191114566-191114588 CTCTTTGGTGCTATTATAAATGG - Intergenic
967698136 3:192558322-192558344 ATTTTTGATGCTATTGTAAATGG - Intronic
967709805 3:192693178-192693200 TTTTTTAATGCTATTATAAATGG - Intronic
968022782 3:195409331-195409353 TATTTTGATGCTATTATAAATGG - Intronic
968732714 4:2277581-2277603 CTTTTTTATGCTATTGTAAAGGG - Intronic
969434219 4:7175858-7175880 CTTTCTGATGCTATTGTGAATGG + Intergenic
969712973 4:8854836-8854858 CATTTTGTAGCTATAATCACAGG + Intronic
969784896 4:9449079-9449101 CTTTTTCTTGCTATTATGAATGG - Intronic
970041322 4:11800119-11800141 CTATGTGATGCTATTTTCAAAGG - Intergenic
970667102 4:18349647-18349669 CTTTTTGATGCTATTGTAAATGG + Intergenic
970733643 4:19139642-19139664 CTTTCTGATGCTATTGTGAATGG - Intergenic
970967332 4:21943674-21943696 ATTTTTGATTCTATAAGTAATGG + Intronic
971211313 4:24619655-24619677 CTTTTTGTTACTATTATAAATGG + Intergenic
971430453 4:26560381-26560403 TTTTTTGATGCTATTATTAATGG + Intergenic
971432854 4:26586713-26586735 GTTTTTGACGCTATTATAAATGG + Intronic
972194207 4:36633120-36633142 CTTTTTGATGTTATTGTAAATGG - Intergenic
972375501 4:38465766-38465788 CTGTATGATACTATAATCATGGG + Intergenic
972497027 4:39643602-39643624 CTTTTTGATGATATTATAAATGG + Intergenic
972582630 4:40408157-40408179 CTTTTTGATGCTATTGTAAATGG - Intergenic
972616925 4:40707779-40707801 ATTTTTGATGCTGTTATAAATGG - Intergenic
972983334 4:44732331-44732353 CTTTTTGATGCTATTGTAAAGGG + Intergenic
973033599 4:45376255-45376277 CTTTCTGATGCTATAGTAAATGG + Intergenic
973196348 4:47447076-47447098 CTTTTTGATGCTATTGTAAATGG - Intergenic
973345864 4:49054748-49054770 TTTTTTGATGCTATTGTAAATGG + Intronic
973689817 4:53415657-53415679 CTTTTAGGTGTTATGATCAAAGG - Intronic
974035692 4:56816231-56816253 CTTTTTGATGCTATTGTAAGTGG - Intronic
974297146 4:60015284-60015306 CTTTTTGTGGCTATAGTGAATGG + Intergenic
974775181 4:66471279-66471301 CTTTTTGGTGCTATTGTAAATGG + Intergenic
974828181 4:67155743-67155765 CTTTTTGTCTCTATCATCAAAGG + Intergenic
975224181 4:71851198-71851220 TTTTTTGATGCTATTGTAAATGG + Intergenic
975286267 4:72624745-72624767 CTTTTTGTGGCTATCATGAATGG - Intergenic
975390374 4:73809755-73809777 ATTTTTGATGCTATTGTAAAAGG - Intergenic
975636488 4:76454901-76454923 CTTTTTGATGCTATTGTATATGG + Intronic
975641890 4:76509178-76509200 CTTTTTGAAGCTATTATAAATGG + Intronic
975896301 4:79095653-79095675 CTTCTTGATACTATCATAAATGG + Intergenic
976244242 4:82991293-82991315 TTTTTTGATGCTGTTATAAATGG + Intronic
976852645 4:89566437-89566459 ATTTTTGATGCTATTATAGATGG + Intergenic
976878244 4:89884437-89884459 GTTTTTGATGCCATTATAAATGG + Intronic
977025842 4:91818455-91818477 ATTTTTGATGCTATTATAAATGG + Intergenic
977650709 4:99465547-99465569 TTTTTTGATGCTATTGTAAATGG + Intergenic
977934927 4:102790961-102790983 CTTTTTGATGCTATTGTATATGG + Intergenic
978122459 4:105096524-105096546 CTTTTTAATGCTATTATAAGTGG - Intergenic
978234147 4:106437532-106437554 CTTTTTAATGCTATTATATAGGG + Intergenic
978266197 4:106828295-106828317 CTTTCTGATGCTATTGTAAAGGG - Intergenic
978266351 4:106830732-106830754 CTTTTTGTTGCTATTGTAAATGG - Intergenic
978278639 4:106982669-106982691 CTTTTTGTTTCTATAAACATAGG - Intronic
978364263 4:107964225-107964247 CTTTTTGCTGCTATTATATATGG - Intergenic
978940560 4:114431247-114431269 CTTTTTGTGGCTATTATAAATGG + Intergenic
979216207 4:118167302-118167324 CTTTTTTATGCTATTATAAATGG - Intronic
979301256 4:119090129-119090151 CTTTTTGTGGCTATAGTGAATGG + Intergenic
979353390 4:119672813-119672835 CTTTATAATGCTGTTATCAATGG + Intergenic
979429174 4:120606679-120606701 TATTTTGATGCTATTATAAATGG + Intergenic
979595142 4:122526226-122526248 CTTGTTGAGGTTATGATCAATGG + Intergenic
980199628 4:129639054-129639076 CATTTTGATGCTATCATAAATGG + Intergenic
980345694 4:131614762-131614784 ACTTTTGATGCTATTATAAATGG + Intergenic
980347802 4:131645242-131645264 GTTTTTGCTGCTTTAATGAAAGG - Intergenic
980381835 4:132031101-132031123 CTTTTTGGTGCTGTCATAAATGG + Intergenic
980466687 4:133195715-133195737 ATTTTTTATGTTATAATCTAGGG - Intronic
980473670 4:133281684-133281706 TTTTTTGATGCTATTGTAAATGG + Intergenic
980477780 4:133341177-133341199 CTTTTTAATACTATAGTAAATGG + Intergenic
980505067 4:133708345-133708367 CTTTTAGATGCTATTGTGAATGG + Intergenic
980506158 4:133726269-133726291 TTTTTCTATGATATAATCAATGG + Intergenic
980752001 4:137102811-137102833 CTTTTTGATGCTATTATAAGTGG - Intergenic
980975788 4:139609127-139609149 CTCTTTGATGCTATTGTTAATGG + Intergenic
981063237 4:140450341-140450363 TTTTTTGATGCTATTATAACGGG - Intronic
981105801 4:140879475-140879497 TTTTTTGATGCTATCATAAATGG + Intronic
981343099 4:143645336-143645358 CTTTTTGATGGAATAGTCACTGG + Intronic
981358940 4:143825436-143825458 CTTTTTGGTGATATAATTCAGGG + Intergenic
981379004 4:144050050-144050072 CATGTTGCTGCTATAAACAAGGG - Intergenic
981625929 4:146755127-146755149 TTTTTTTATGCTATTATTAATGG - Intronic
981703651 4:147635881-147635903 TTTTTTTATGCTATCATAAATGG - Exonic
981705070 4:147650416-147650438 TTTTTAGATGCTATTATAAATGG - Intronic
981766817 4:148260476-148260498 CTCTTTGATGCAAAAATAAAAGG - Intronic
982076654 4:151744033-151744055 CTTTTTGATCCTACAGTAAATGG - Intronic
982185828 4:152797691-152797713 CTTTTTATTGCTATTATAAATGG + Intronic
982215300 4:153077900-153077922 CTTTTTGATGCTATTGTAAGTGG - Intergenic
982525197 4:156468681-156468703 CTTATTGGTGCTATTATAAATGG - Intergenic
982883866 4:160753165-160753187 TTTTTTGAAGCTATTATAAATGG + Intergenic
982950691 4:161691768-161691790 CTTTTAGATACTATCATGAATGG + Intronic
982997888 4:162374338-162374360 CTTTCTGATGCTACACCCAAGGG + Intergenic
983176986 4:164601427-164601449 CTTTTTGTGGCTATTATAAATGG - Intergenic
983655319 4:170077441-170077463 CTTTTGGATGCTATTACAAATGG + Intronic
983665270 4:170174632-170174654 TTTTTTGATGCTATTATAAATGG + Intergenic
983744136 4:171173780-171173802 TCTTTTGATGCTATTATAAATGG + Intergenic
984073281 4:175143814-175143836 CTTTTTGATACTATCACAAATGG + Intergenic
984079057 4:175220141-175220163 CTTTTTGATACTATCACTAATGG + Intergenic
984116618 4:175689458-175689480 CTTTTTGAAGCTATTGTAAATGG + Intronic
984129641 4:175857954-175857976 TTTTTTGATGCTATTATAAATGG - Intronic
984222775 4:176998182-176998204 ATTTTTGATGCTATTATAAATGG - Intergenic
984419757 4:179505749-179505771 CTTTTTGCTGCTACATTAAATGG + Intergenic
985088857 4:186343152-186343174 TTTAGTGATGCTAAAATCAAGGG - Intergenic
985215175 4:187645173-187645195 ATTTTTGATGCTATTTTAAATGG - Intergenic
985479453 5:99489-99511 CTTTTAGATGCTATTGTGAATGG + Intergenic
985976994 5:3427768-3427790 GTTTTTAATACAATAATCAATGG - Intergenic
986071909 5:4293768-4293790 CTTTTTGAAGCTGTAAGCCAAGG - Intergenic
986122280 5:4851923-4851945 TTTTTTGATGCTATTATAAATGG - Intergenic
986500545 5:8394444-8394466 CTTTTTGATGTTATTATAAATGG - Intergenic
986620768 5:9671530-9671552 CTTTTTGTGGCTATCATGAATGG - Intronic
987785187 5:22490148-22490170 ATTTTTCCAGCTATAATCAAAGG - Intronic
987869257 5:23591845-23591867 CTTTATTATGCTTTATTCAATGG - Intergenic
988319370 5:29672345-29672367 CCTTTTGATCCTATATTCAGTGG - Intergenic
988626806 5:32885580-32885602 CTTTTTGCTGCTACTATAAATGG + Intergenic
988820933 5:34884677-34884699 CTTTTTGATGCTATTGTAAATGG - Intronic
989013130 5:36896969-36896991 CTTTTTAATGCTATTGTAAATGG + Intronic
989274861 5:39576276-39576298 TTCTTTGATGCTATAATGAATGG - Intergenic
989443146 5:41495457-41495479 CTTTTTGATGGGATACCCAAGGG + Intronic
989447191 5:41543680-41543702 TTTTTTGATGTTATTATAAATGG + Intergenic
989765932 5:45083534-45083556 CTTTTTGATGCTATTATTAATGG - Intergenic
990015622 5:51058418-51058440 CTGTCTGATGCTAAAACCAATGG - Intergenic
990918347 5:60935286-60935308 TTTTTTGAAGCTATTATAAAAGG + Intronic
991211784 5:64113840-64113862 CTTTTTGAGGTCATCATCAATGG - Intergenic
991390444 5:66137403-66137425 CTTTTTGATGCTATTGGGAAAGG - Intergenic
991523221 5:67524888-67524910 CTTTTTGGTGCTATTGTAAACGG - Intergenic
991611722 5:68456432-68456454 GTTTTTGATGCTAATAGCAATGG + Intergenic
992065935 5:73108320-73108342 CTTTTTGGTGCTATTATAAATGG + Intergenic
992182174 5:74208558-74208580 CTTTTTTATGCTATATCAAATGG - Intergenic
992245447 5:74817436-74817458 TTTTTTGATGCTATTATGAATGG - Intronic
992342406 5:75838539-75838561 CTTTTTGATTCTATCATAAATGG + Intergenic
992550407 5:77854355-77854377 CCTTTTCATGCTGTAATCGAAGG - Intronic
992799770 5:80285351-80285373 CTTTTTGGTGCTATTGTAAATGG - Intergenic
992835141 5:80633214-80633236 CCTTTTGATGCTATTGTAAATGG - Intronic
992913495 5:81422730-81422752 TTTTCTGCTGCTATGATCAAGGG - Intronic
993173924 5:84457709-84457731 TTTTTTGTTGCTATTATAAATGG - Intergenic
993303729 5:86248849-86248871 CTTTTTGATGCCATTGTAAATGG - Intergenic
993362383 5:86993828-86993850 CTTTTTGAAGCTATCGTGAATGG + Intergenic
993433197 5:87857412-87857434 GTTTTTGATGCTATTATAACTGG - Intergenic
993625332 5:90217456-90217478 CTTTTTGAAGCTATTGTAAATGG - Intergenic
993823376 5:92649097-92649119 CCTTTTGATGCTATTATAAATGG - Intergenic
994614208 5:102082814-102082836 CTTTTTGTGGCTATTATGAATGG - Intergenic
994810355 5:104509955-104509977 CTTTTTGATGCTACTGTAAATGG + Intergenic
994868551 5:105313607-105313629 ATTTTTGATGCTATTTTAAATGG + Intergenic
994880102 5:105480259-105480281 ATTTTTGAGGCTATGATAAATGG - Intergenic
994880992 5:105495947-105495969 CTTTTTGATGCTACTGTAAATGG - Intergenic
994903675 5:105807766-105807788 CCTTTTGATGCTATTAGTAAAGG + Intergenic
995052961 5:107727208-107727230 CTTTATGATACTATAATGATGGG + Intergenic
995099588 5:108282897-108282919 TTTTTTGTTGCTATTATAAAAGG - Intronic
995105761 5:108376474-108376496 CTTTTTGATGCTATTATAAATGG - Intronic
995735022 5:115290730-115290752 CTTTGTGATACTATTATCAATGG + Intronic
996245529 5:121259422-121259444 CTTTTTGTGGCTATAATGAATGG + Intergenic
996270021 5:121592949-121592971 ATTTCTGATGCTATTATAAATGG - Intergenic
996321727 5:122224695-122224717 TTTTTTGATGCTATTGTAAATGG - Intergenic
996390692 5:122957774-122957796 CTCTTTGATGCTATTGTGAATGG + Intronic
996521658 5:124434152-124434174 CTTTTTGATGCTATTGTAAATGG - Intergenic
996686673 5:126289951-126289973 CTTTTTGATGCTTTTATAAATGG - Intergenic
996782569 5:127203691-127203713 CTTTTTGGTGCTATTATAGATGG - Intergenic
996846835 5:127909028-127909050 CTTCTTCATGCTGTAATCTAGGG - Intergenic
996933646 5:128922219-128922241 CTTTTTGGTGCTATTATAAATGG - Intronic
997086053 5:130800881-130800903 CTTTTTGAAGCTATTATAAATGG - Intergenic
997343547 5:133167117-133167139 GTTTTTGATGCTATTGTAAATGG + Intergenic
997497490 5:134342208-134342230 CTTTTTGATGCTATCATGAATGG - Intronic
997620467 5:135287546-135287568 CTTTTTGATGCTATCATACATGG + Intronic
997810882 5:136967732-136967754 CTTTTTGTTGCTATAGTAAATGG + Intergenic
997881110 5:137590863-137590885 CTTTTTGATGGTATTTTAAATGG - Intronic
998181272 5:139945854-139945876 CTTTTTGATGCTATTATAAATGG - Intronic
998617344 5:143754603-143754625 CTTTTTTATACTTTAAACAAAGG + Intergenic
998727602 5:145035736-145035758 ATTTTTGATGCTATGATAAATGG - Intergenic
999544282 5:152609695-152609717 CTTTGTGATCCTATTTTCAAAGG + Intergenic
999556646 5:152750614-152750636 ATGTTTGATGCTATTATAAATGG - Intergenic
999915946 5:156260475-156260497 GTTTTTGATGCTATTGTAAATGG + Intronic
1000283612 5:159805711-159805733 CTTTTTAATGCTATTGTAAATGG - Intergenic
1001358218 5:171053471-171053493 CTTTTGAATGCTATTATAAATGG + Intronic
1001552514 5:172613818-172613840 CTTTTTGTAGCTATTGTCAATGG - Intergenic
1001800206 5:174537050-174537072 CTTTCTGATGCTATTGTAAATGG - Intergenic
1001867480 5:175117808-175117830 CTTTTTGGTCCTATAGACAATGG + Intergenic
1001908785 5:175496409-175496431 TTTTTTGACACTATAATCTAGGG - Intronic
1001996391 5:176163250-176163272 TTTTTAGATGCTATTATAAATGG - Intergenic
1002002537 5:176206061-176206083 ATTTTTGATGCTATTGTAAATGG + Intergenic
1002224063 5:177705551-177705573 ATTTTTGATGCTATTGTAAATGG - Intergenic
1002420420 5:179144174-179144196 CTTTTTGGTGCTATTGTAAATGG - Intronic
1002767041 6:250491-250513 CTTTTTGATACTATTATAAATGG + Intergenic
1002998382 6:2308007-2308029 CTTTTTGATGCTAATAGGAATGG + Intergenic
1003164874 6:3668365-3668387 GTTTTTGATGCTATTATTAATGG - Intergenic
1003206060 6:4013157-4013179 CCTTTTGATGCTATTGTAAATGG - Intergenic
1003230487 6:4247719-4247741 TTCTTTGATGCTATTATAAATGG + Intergenic
1003263129 6:4541411-4541433 CTTCTTGATGCTATTGTAAATGG - Intergenic
1004113223 6:12742006-12742028 GGTTTTGATGCTATTATAAATGG + Intronic
1005089335 6:22040324-22040346 GTTTTTGATGCTATTATAAATGG + Intergenic
1005159366 6:22841202-22841224 TTTTTTGATGCTATAATAAATGG - Intergenic
1005235106 6:23751507-23751529 TTTTTTGATGCTATTGTAAATGG + Intergenic
1005369765 6:25119946-25119968 CTTTTTGATGCTATTGTAAATGG - Intergenic
1005715801 6:28546821-28546843 CTTGTTGATGCTATTGTAAATGG + Intergenic
1005746667 6:28844561-28844583 CTTTTTGGTGCTATAGTAAATGG - Intergenic
1007354311 6:41300652-41300674 CTTTTTGTGGCTATTGTCAATGG - Intergenic
1007868948 6:45010085-45010107 CTTTTTGATGCTATTGTAAATGG + Intronic
1008020287 6:46569130-46569152 CATTTTTATGCTATTATAAATGG + Intronic
1008532147 6:52472522-52472544 ATTTTTGATGCTATAGTAAATGG - Intronic
1008795498 6:55297970-55297992 CTTTTTGTAGCTATTATAAATGG + Intergenic
1008943997 6:57077204-57077226 TATTTTGATGCTATTATAAATGG + Intergenic
1008972686 6:57388023-57388045 CTTTTTGATTCTAAAAAAAAAGG - Intronic
1009273353 6:61643696-61643718 CTTTTTGTGGCTATTATGAATGG - Intergenic
1009540497 6:64950430-64950452 CTTTTTGATCCTAAAAACATTGG - Intronic
1009678882 6:66864728-66864750 ATTTTTGATGCTATGGTAAACGG - Intergenic
1010007011 6:71006752-71006774 TTTTTTGATGCTAACATAAAAGG + Intergenic
1010249074 6:73689850-73689872 ATTTCTGATCTTATAATCAATGG - Intergenic
1010304149 6:74298536-74298558 CTTTTTGTTACTATTATAAATGG - Intergenic
1010322711 6:74531276-74531298 CTTTTTGTGGCTATTATAAATGG - Intergenic
1010558817 6:77321826-77321848 CTTTTACATCCTATACTCAATGG + Intergenic
1010598627 6:77796605-77796627 ATTTTTGATGCTATTATAAATGG - Intronic
1011087976 6:83563753-83563775 ATTGTTGATGCTATTATAAATGG - Intronic
1011808379 6:91099328-91099350 CTCTTTGATGGTAGAAGCAATGG - Intergenic
1011852230 6:91644321-91644343 CTTTTTGATGCTCTTGTAAATGG - Intergenic
1012560883 6:100580076-100580098 CTTTTTGTTGCTATTGTGAATGG + Intronic
1012577348 6:100819324-100819346 GTTTTTGATGCTATTGTAAATGG - Intronic
1012847073 6:104403954-104403976 CTTTTTGATGCTATTTTAAATGG - Intergenic
1013181930 6:107724524-107724546 CTTTTTCATACTATTATAAATGG - Intronic
1013320657 6:108984661-108984683 CTTTTTGATCCTATTGTAAATGG + Intergenic
1013710029 6:112886481-112886503 CTATTTGACTCTAGAATCAAGGG - Intergenic
1014119015 6:117701627-117701649 CTTTTTGATGCTGTTGTTAATGG + Intronic
1014275923 6:119388739-119388761 ATTTTTGATGCTATTATAAATGG - Intergenic
1014286104 6:119500380-119500402 GTTTTTGATGCTATAATAAATGG + Intergenic
1015011633 6:128356314-128356336 CTTATTGAAGGTATAATCAACGG + Intronic
1015314343 6:131801158-131801180 GTTTTTGATGATATTATGAATGG - Intergenic
1015482858 6:133733204-133733226 CTTTTTGATGCTATTATAAATGG - Intergenic
1015808548 6:137138114-137138136 TTTTTTGATACTATCATAAATGG - Intergenic
1015898855 6:138043863-138043885 ATTTTTGATGCTATTATAAATGG + Intergenic
1016192819 6:141291712-141291734 AGTTTTTATGCTATCATCAAGGG - Intergenic
1016308133 6:142704708-142704730 TTTTTTGATGCCATATTCAAGGG - Intergenic
1016516792 6:144902246-144902268 CTTTTTGATGCTGTTCTCAATGG + Intergenic
1017287505 6:152693268-152693290 CTTTTTAATGCTATTGTAAATGG + Intergenic
1017547825 6:155470397-155470419 GTTTTTGTAGCTATAATTAAAGG - Intergenic
1017785095 6:157749882-157749904 CTTTTTGATGTTATAGTAAGTGG - Intronic
1018518573 6:164616845-164616867 GGTTTTGCTACTATAATCAAAGG - Intergenic
1018591300 6:165425946-165425968 TTTTTTAATGCTATTATAAATGG - Intronic
1018865160 6:167741161-167741183 GTTTTTGATGCTATTTTAAATGG + Intergenic
1019087692 6:169496682-169496704 CTTTTTGATGCTATTGTGAATGG - Intronic
1019574595 7:1730406-1730428 CTTTTTGATCCAATATTCACGGG - Intronic
1019617189 7:1969759-1969781 CTTTTTGATGCTGTTATGAATGG - Intronic
1019948758 7:4352947-4352969 CTTTTTGATGCTGTTATAAATGG + Intergenic
1020214105 7:6176172-6176194 CCTTTTAATGCTATTATAAATGG + Intronic
1020389701 7:7645039-7645061 GTTTTTGTTGCTATTATGAATGG + Intronic
1020738402 7:11982734-11982756 CTTTTTGGTGCTATGATAAATGG - Intergenic
1020772530 7:12412987-12413009 TTTTTTGATGCTATTGTAAATGG + Intergenic
1020919785 7:14248596-14248618 TTTTTTGATGCTATTTTAAATGG + Intronic
1021199128 7:17707949-17707971 TTTTTTGATGCTATTGTAAATGG - Intergenic
1021255113 7:18382800-18382822 TTTTTTGTTGCTATCATGAATGG - Intronic
1021825133 7:24543046-24543068 CTTTTTGATGCTGTTGTAAAGGG + Intergenic
1021832925 7:24635299-24635321 CTTTTTGCTGCTGTTATGAATGG + Intronic
1021966016 7:25919492-25919514 ATTTTTGATACTATCATAAATGG - Intergenic
1022387076 7:29911156-29911178 CTTTTCTATGCTATCATAAATGG - Intronic
1022401183 7:30039566-30039588 CTTTTTGATGTTATCGTAAATGG + Intronic
1022787588 7:33653701-33653723 CTGTTTGATGCTCTGAGCAAAGG + Intergenic
1022984228 7:35634984-35635006 GTTTTTGATGCCAAAAGCAAGGG - Intronic
1023097500 7:36676352-36676374 CTTTTTGATGCTACTGTAAATGG - Intronic
1023191005 7:37582918-37582940 CTTTTTGATGCTATTATAAATGG + Intergenic
1023235128 7:38078155-38078177 TTTTTTAAGGCTATAATAAATGG - Intergenic
1023244931 7:38192129-38192151 GTTTTTGATGCTATTTTAAATGG + Intronic
1023597611 7:41848469-41848491 CTTTTAGATGCTATTGTAAATGG + Intergenic
1023934715 7:44731174-44731196 CATTTTGATGCTATTAAAAATGG - Intergenic
1024008794 7:45250100-45250122 CTTTTTGATGCTATTGTAAGAGG - Intergenic
1024572530 7:50735198-50735220 ATTTTTGATGCTATTGTAAATGG - Intronic
1024861766 7:53852863-53852885 CTTTTTGATGCTCTTGTAAATGG + Intergenic
1025195892 7:56932818-56932840 CTTTTTGATGCTACTATAAATGG + Intergenic
1025676056 7:63644117-63644139 CTTTTTGATGCTACTATAAATGG - Intergenic
1026439330 7:70430222-70430244 CTTGGTGATGCTATTACCAAGGG + Intronic
1026485488 7:70816677-70816699 CTTTTTCATGCTATTGTAAATGG - Intergenic
1026516326 7:71076307-71076329 CTTTTTGGTGCTATTGTAAATGG - Intergenic
1026591968 7:71704261-71704283 CTTTTTGATGCTATTGTAAATGG - Intronic
1026782209 7:73276146-73276168 CTTTTTGATGCTATTGTAAATGG - Intergenic
1026792023 7:73340159-73340181 CTTTTTGATGCTATTGTAAATGG + Intronic
1026908242 7:74076339-74076361 CTTTTTGATGCTATTATAAATGG - Intergenic
1027022970 7:74828991-74829013 CTTTTTGATGCTATTGTAAATGG - Intronic
1027064955 7:75116319-75116341 CTTTTTGATGCTATTGTAAATGG + Intronic
1027191390 7:75997848-75997870 CTTTTTGATGCTACTGTAAATGG - Intronic
1027429919 7:78100942-78100964 CTTTTTGATGCTATTGTAAATGG - Intronic
1027444008 7:78251609-78251631 CTTGTTGATGTTATTGTCAATGG - Intronic
1027506623 7:79023726-79023748 CTTTTTGTTGCTATTGTGAATGG - Intronic
1027749459 7:82124015-82124037 CTTTTTGCTTCTAAAATAAATGG - Intronic
1028059548 7:86294016-86294038 CTTTTTGATTCCATTATAAATGG - Intergenic
1028087716 7:86656561-86656583 CTTTGTGATGCTATATTCTTTGG + Intronic
1028732083 7:94162556-94162578 CTTTTTGAGGCAATAATCTTAGG + Intergenic
1028771348 7:94626480-94626502 ATTTTTGTTGCTATTAACAATGG + Intronic
1028805140 7:95017482-95017504 ATTTTTGGTGCTATTATAAACGG - Intronic
1028877371 7:95838773-95838795 CTTTCTGATGCTATTATTAGTGG + Intronic
1029248459 7:99219239-99219261 CCTTTTGATGGTTTACTCAAGGG - Intergenic
1029325592 7:99805444-99805466 CTTTTTGATGCTATTGTAAATGG - Intergenic
1029674141 7:102055187-102055209 TTTTGTGATGCTATTATAAATGG + Intronic
1029925764 7:104315227-104315249 TTTTTTGATGCTACATTAAATGG - Intergenic
1029932644 7:104389265-104389287 ATTTTTGATGCTATTGTAAATGG - Intronic
1030410372 7:109170314-109170336 CTTTTTGATGCTATTGTAAATGG - Intergenic
1030425702 7:109374512-109374534 TTTTTTGTAGCTATAATTAAAGG - Intergenic
1030451973 7:109723496-109723518 CTTTTTGATGCAATTGTGAATGG - Intergenic
1031079458 7:117244035-117244057 CTTTTTGATGCTACTATAAATGG - Intergenic
1031191633 7:118560030-118560052 ATTTTTGATGCTACTATAAATGG - Intergenic
1031275492 7:119716315-119716337 TTTTTTTATGCTATTGTCAATGG - Intergenic
1031537239 7:122950303-122950325 TGTTTTGAGGCTAAAATCAAAGG - Intergenic
1032774209 7:135093500-135093522 CTTTTTGATGCTAATGTAAATGG - Intronic
1033081177 7:138298875-138298897 CTTTTTTATGTTATTATAAATGG + Intergenic
1033225246 7:139556944-139556966 ATTTTTGATGCTATTATAGATGG + Intergenic
1033275673 7:139969988-139970010 CTTTGTGATGCCCTAACCAAGGG - Intronic
1034053587 7:148010531-148010553 TTTTTTAATGGTATAATCTAAGG + Intronic
1034138495 7:148794804-148794826 CTTTTTGATGCTATTATAAATGG + Intronic
1034249832 7:149680213-149680235 CTTTTTGAAACTATTATAAATGG + Intergenic
1034354377 7:150441142-150441164 CTTTTTGGTGCTATTATAAATGG + Intergenic
1034597553 7:152212644-152212666 CTTTTTGATGTTATTTTAAATGG - Intronic
1034742517 7:153490944-153490966 ATTTTTGATGCTATTGTAAATGG - Intergenic
1034840929 7:154395502-154395524 CTTTTTGATGCTGTTGTAAATGG + Intronic
1034905178 7:154938345-154938367 CTTTTTAATGCTATTGTAAATGG + Intronic
1035013628 7:155743672-155743694 CTTGATGATGATATAATAAAGGG + Intronic
1035172563 7:157026457-157026479 CTTTTTGATGCTATTGTAAATGG + Intergenic
1036092693 8:5685382-5685404 CTTTTTCATACTATTATTAATGG + Intergenic
1036834137 8:12045051-12045073 CTTTTTCTTGCTATTATGAATGG + Intergenic
1036855981 8:12291616-12291638 CTTTTTCTTGCTATTATGAATGG + Intergenic
1037452466 8:19029765-19029787 CTTTTTGATGCTACTGTAAATGG + Intronic
1037601405 8:20398414-20398436 CTTTCTGATGCTATTCTAAATGG + Intergenic
1037713721 8:21378025-21378047 CTTTTTAATGTTAGATTCAAGGG + Intergenic
1037851032 8:22328680-22328702 CTTTTGGATGCTATTGTAAATGG + Intronic
1038001227 8:23392950-23392972 ATTTTTGATGCTATTGTAAATGG - Intronic
1038116206 8:24558520-24558542 CTTTTTGTGGCTATTATGAATGG - Intergenic
1038556000 8:28516631-28516653 ATTTTTGATGCTCTTATAAATGG + Intronic
1038915762 8:32020248-32020270 GTTTTTGATGCTATGCTAAATGG + Intronic
1039158671 8:34592261-34592283 CTTTTTAGTGCTATTATAAATGG + Intergenic
1039206049 8:35156310-35156332 CTTTTTGTGGCTATTATAAATGG - Intergenic
1039293058 8:36119977-36119999 CTTTTTGATGCCATTGTAAATGG - Intergenic
1039398843 8:37250528-37250550 CTTTTAGATGCCATTATAAATGG - Intergenic
1039643600 8:39253660-39253682 CTTTTTGATGCTGTTGTAAATGG - Intronic
1039654332 8:39383482-39383504 CTTTTTGATGCTATCATAAATGG + Intergenic
1039939894 8:42081164-42081186 CTTTCTGATGCTATTGTAAATGG + Intergenic
1040076711 8:43243873-43243895 TTCTTTGATGCTATTATAAATGG + Intergenic
1040509249 8:48079129-48079151 CTTTTTGATGCTATCATACCTGG + Intergenic
1040509346 8:48080473-48080495 CTTTTTGATGCTATTGTAAATGG - Intergenic
1040547928 8:48415597-48415619 CTTTTGGATGCTATTGTAAATGG - Intergenic
1040986557 8:53300517-53300539 CTTTTTGTGGCTATCATAAATGG + Intergenic
1041160120 8:55032668-55032690 ATTTTTCATGCTATCATAAAGGG - Intergenic
1041229313 8:55732860-55732882 CTTTTTTATGCTATTGTAAATGG - Intronic
1041336576 8:56791555-56791577 ATTTTAGATGCTATTATAAATGG - Intergenic
1041514024 8:58680343-58680365 CTTCTTGATGCTATTGTAAATGG - Intergenic
1041563862 8:59252627-59252649 TTTTTTGATGTGATATTCAATGG + Intergenic
1041947533 8:63462901-63462923 ATTTCAGATGCTATAAACAAAGG + Intergenic
1042021271 8:64372835-64372857 CTTGTTGATGTTCTTATCAAGGG - Intergenic
1042286678 8:67120610-67120632 CTTTTGGATGCTTTCATAAATGG + Intronic
1042363315 8:67907527-67907549 CTTTTTAATGGTATTATGAAAGG - Intergenic
1042587442 8:70357256-70357278 CTTTTGGATGCTATGGTAAATGG - Intronic
1043216636 8:77599666-77599688 CTTTTTGATGGTATTATAAATGG - Intergenic
1043222317 8:77682431-77682453 CTGGTAGATGCCATAATCAAAGG - Intergenic
1043258537 8:78167176-78167198 CTTATTGATGCTATTGTAAATGG - Intergenic
1043864748 8:85362047-85362069 GTTTTTGGGGCTAAAATCAAGGG + Intronic
1043945387 8:86245229-86245251 CTTTTTGTTGCTATTATGAATGG - Intronic
1044002170 8:86896550-86896572 TTTTTTGATACTATCATAAAGGG + Intronic
1044272073 8:90257707-90257729 GTTTTTGATACTATTATAAATGG - Intergenic
1044334762 8:90967815-90967837 CTTTTTGATGCTATTGTAAATGG - Intronic
1044615788 8:94139237-94139259 TTTTTTCCTGCTATATTCAATGG - Intronic
1044642348 8:94396653-94396675 CTTTTCTATGATATAATGAAAGG + Intronic
1044671811 8:94689394-94689416 ATTTTTGATGCTATAGTGAATGG + Intronic
1044765506 8:95568866-95568888 CTTTTTGATACTGTTATAAATGG + Intergenic
1045072582 8:98524594-98524616 CTTTTTGATGCTATTATCAATGG + Intronic
1045076638 8:98576635-98576657 CTTTTGGATGCTATTATAAATGG + Intronic
1045847232 8:106652005-106652027 CTTTTTGATGCTACTATAAATGG + Intronic
1046218256 8:111178573-111178595 CTATTTGATATTATTATCAACGG + Intergenic
1046323396 8:112608196-112608218 CTTTTTTATGCTATTATACATGG - Intronic
1046474616 8:114725843-114725865 TTTTATGCTGCTTTAATCAACGG - Intergenic
1046646999 8:116796185-116796207 CTTTATTATGCTATCATAAATGG + Intronic
1046682807 8:117191069-117191091 CTTTTTGATGCTATAACAAATGG - Intergenic
1047265462 8:123303462-123303484 CTTTTTGTTGCTATTGTAAATGG + Intergenic
1047282106 8:123454770-123454792 CTTCTTGATGGTAGAATGAATGG - Intronic
1047466766 8:125124295-125124317 CTTTTTGATTCTATTATAAATGG + Intronic
1047485103 8:125322836-125322858 ATTTTTGATGATATCATAAATGG - Intronic
1047935541 8:129773805-129773827 ATTTTTGATGCTATTATAAACGG - Intronic
1048129841 8:131683414-131683436 TTTTTTGATGCTATTGTAAATGG - Intergenic
1048617050 8:136087307-136087329 CTTTTTGATGCCATTATAAATGG + Intergenic
1048617729 8:136096350-136096372 TTTTTGGATGCTATCATGAATGG + Intergenic
1048778690 8:137977523-137977545 CTGTATGATGCTATAATGATGGG + Intergenic
1049078451 8:140420092-140420114 CTTTTTCATGCTATTGTAAATGG - Intronic
1049567912 8:143351622-143351644 TTTTTTGATGCTATTGTAAATGG - Intronic
1049739990 8:144234455-144234477 CTTTTTGATGCTATTGTAAATGG + Intronic
1049993754 9:1015355-1015377 ATTTTTGATGCCATTATAAATGG + Intergenic
1050059895 9:1696638-1696660 CCTTTTGATGCTATTATAAAAGG - Intergenic
1050440641 9:5659760-5659782 CTTTTTGATGCTATTGTAAATGG + Intronic
1050444560 9:5705403-5705425 CTTTTTGATGCTATTGTAAATGG + Intronic
1050659022 9:7862783-7862805 CATTTTCATGCTATAATAAAAGG - Intronic
1050698315 9:8304660-8304682 CTTTTCGATGCTATTGTAAATGG + Intergenic
1050860783 9:10427703-10427725 CTTTTTTTTGCTATATCCAAGGG - Intronic
1051133307 9:13888532-13888554 TTTTTTGATGCTATTGTAAATGG - Intergenic
1051168173 9:14287856-14287878 TTTTTTGCTGCTAAAAGCAATGG - Intronic
1051202565 9:14644136-14644158 TTTTTTGATTCTATTATAAATGG + Intronic
1051245531 9:15107084-15107106 CTTTTTGATATTATTATAAATGG - Intergenic
1051293315 9:15567982-15568004 CTTTTTGATGCTGTTATAAATGG + Intronic
1051500695 9:17774046-17774068 CTTTTTGATACTATTGTAAATGG + Intronic
1051704038 9:19857610-19857632 CTTTTTGAAGCTATTATAAATGG + Intergenic
1051713064 9:19952072-19952094 ATTTTTGATGCTATTATAAATGG + Intergenic
1051815604 9:21102007-21102029 CTTTTTGATGTTATTATAAATGG + Intergenic
1051989286 9:23131631-23131653 TTTTTTGATGCTATGGTAAAAGG - Intergenic
1052128592 9:24811552-24811574 CTTTTTGATGCTACTATAAATGG - Intergenic
1052749427 9:32474237-32474259 TTTTTTGATGCTATTATAAATGG - Intronic
1052751577 9:32497287-32497309 CTTTTTAATGCTATTATAAATGG + Intronic
1053322160 9:37108437-37108459 CTTCTGGATGCTATTATGAATGG - Intergenic
1053493989 9:38535721-38535743 ATTTTGGATGCTATTATAAAAGG + Intergenic
1053522616 9:38796252-38796274 CATTTTTATGCTATTATAAATGG + Intergenic
1053599708 9:39598358-39598380 TTTTTTGATGCAATTATCAATGG + Intergenic
1053606196 9:39662449-39662471 CTTTTTGATGCTCTTGTAAAGGG - Intergenic
1053730437 9:41050274-41050296 TTTTTTGATGCTATCATAAATGG + Intergenic
1053751834 9:41264982-41265004 CTTCTTAATGCTATTTTCAATGG - Intergenic
1053752563 9:41271781-41271803 TTCTTTGATGCTATTATAAATGG - Intergenic
1053857410 9:42352544-42352566 TTTTTTGATGCAATTATCAATGG + Intergenic
1053864118 9:42419064-42419086 CTTTTTGATGCTCTTGTAAAGGG - Intergenic
1054194844 9:62020675-62020697 CATTTTTATGCTATTATAAATGG + Intergenic
1054247344 9:62679967-62679989 CTTTTTGATGCTCTTGTAAAGGG + Intergenic
1054253819 9:62744029-62744051 TTTTTTGATGCAATTATCAATGG - Intergenic
1054257357 9:62829310-62829332 CTTCTTAATGCTATTTTCAATGG - Intergenic
1054258090 9:62836133-62836155 TTCTTTGATGCTATTATAAATGG - Intergenic
1054333956 9:63786418-63786440 CTTCTTAATGCTATTTTCAATGG + Intergenic
1054561462 9:66714502-66714524 CTTTTTGATGCTCTTGTAAAGGG + Intergenic
1054567882 9:66778191-66778213 TTTTTTGATGCGATTATCAATGG - Intergenic
1054643564 9:67568015-67568037 CATTTTTATGCTATTATAAATGG - Intergenic
1054698061 9:68381792-68381814 TTTTTTGATGCTATCATAAATGG - Intronic
1055083078 9:72286679-72286701 CTTTTTGGTGCTATTATAAATGG + Intergenic
1055140092 9:72867276-72867298 CTTTTTGATGCTATGGTAAATGG + Intergenic
1055152420 9:73018604-73018626 TTTTTTGATGCTATTGTAAACGG + Intronic
1055349612 9:75372866-75372888 CTTTATTATGTTATAATCAGGGG - Intergenic
1055378214 9:75674207-75674229 TTTTTTGATGCAATTATAAATGG + Intergenic
1055820892 9:80262255-80262277 ATTTTTGATGCTGTTATAAATGG - Intergenic
1055919464 9:81443141-81443163 CTTTTTGTTGCTATTGTGAATGG - Intergenic
1056159687 9:83876310-83876332 CTTTTAGATGCTATTATAAATGG - Intronic
1056163083 9:83917218-83917240 CTTTTTGATGCTATTGTAAATGG - Intronic
1056350891 9:85747618-85747640 CTTTTAGATGCTATTATAAATGG + Intergenic
1056480543 9:86999519-86999541 ATTTTTGATGCTGTTATAAATGG + Intergenic
1056861323 9:90185942-90185964 TTTTTAGATGCTATTGTCAACGG + Intergenic
1056924793 9:90825095-90825117 CTTTTTGGTGCTATTATACATGG - Intronic
1056971179 9:91205134-91205156 CTTTTTGATGCTACTGTAAATGG - Intergenic
1057002599 9:91526084-91526106 CTTTTTGATGCTATTTTAAATGG - Intergenic
1057005986 9:91560111-91560133 CTTTTTGATGCTACTTTAAATGG + Intergenic
1057238799 9:93390726-93390748 CTTTTTGATGCTACTGTAAATGG + Intergenic
1057258749 9:93571906-93571928 CTTTTTGATGCTACTATAAATGG - Intergenic
1057411680 9:94821773-94821795 CTTTTTGGTGGTAACATCAATGG + Intronic
1057685050 9:97224764-97224786 TTCTTTGATGCTATTATAAATGG - Intergenic
1057753900 9:97814724-97814746 ATTTTTGATGCTATTGTAAATGG + Intergenic
1057756229 9:97839059-97839081 CTTTTTGATGCTATTGTAAATGG - Intergenic
1058488688 9:105470498-105470520 CTTTTTGATACTATTATAAGTGG + Intronic
1058572526 9:106362506-106362528 ATTTTTGATGCTATTGTAAATGG + Intergenic
1058609421 9:106758753-106758775 CTTTTTGATTCTATTGTAAACGG - Intergenic
1058666758 9:107325492-107325514 CTTTTTGATGCTGTTATAAATGG + Intronic
1059066086 9:111085783-111085805 CTTTTCGGTGCTATCATAAATGG + Intergenic
1059211594 9:112516349-112516371 GTTTTTGATGCTATTACAAATGG - Intronic
1059264726 9:113016169-113016191 CTTTTTGATGCTATTGTAAATGG + Intergenic
1059336359 9:113571176-113571198 CAGTTTGAGGCTATAATGAATGG + Intronic
1059358704 9:113721742-113721764 CTTTTTGATGGTATTTTAAATGG - Intergenic
1059439439 9:114297958-114297980 CTCTTTGATGCTATTATAAATGG - Intronic
1059815900 9:117914559-117914581 CTATTTAATGCTATTATAAATGG - Intergenic
1060017755 9:120101583-120101605 CTTATTGTTGTTATCATCAAAGG - Intergenic
1060257134 9:122041663-122041685 CTTTTTGATGCTATTATAAATGG - Intronic
1060460088 9:123844458-123844480 CTTTTTGATGTTATTGTAAATGG - Intronic
1061685502 9:132273561-132273583 CTTTTTGATGCTATTGTAAATGG + Intronic
1202800689 9_KI270719v1_random:172243-172265 TTCTTTGATGCTATTATAAATGG + Intergenic
1185493887 X:539746-539768 CTTTTCGATACTAGAATCATTGG + Intergenic
1185919708 X:4077578-4077600 TTTTCTGATGCAATAATCACAGG + Intergenic
1185949532 X:4416139-4416161 CTTTGTGATGCTATAATGAAGGG - Intergenic
1186195103 X:7102829-7102851 TCTTTTGATGCTATTATAAATGG - Intronic
1186560344 X:10605522-10605544 CTTTGTAATCCTATAAACAAAGG + Intronic
1187099155 X:16174093-16174115 CTTTTTGATGCTATTATAAATGG - Intergenic
1187118550 X:16380453-16380475 CTTTTTGATGCTATTATAAATGG - Intergenic
1187222462 X:17341897-17341919 TTTTTTGATGCTATTCTAAATGG + Intergenic
1187258653 X:17664953-17664975 ATTTGTGATGCTATCATAAATGG + Intronic
1187371571 X:18712404-18712426 CTTTTTGATGATATTATACATGG + Intronic
1187382139 X:18812728-18812750 CCTTTTGCTGCTATAGTAAATGG + Intronic
1188079651 X:25821343-25821365 CTTTTTGATGCTGTTGTAAATGG - Intergenic
1188087075 X:25912725-25912747 CTTTTTGATGCTATTGTTAATGG + Intergenic
1188867673 X:35333647-35333669 CTTCTTGATGCTATCATAAATGG + Intergenic
1189092261 X:38097450-38097472 ATTTTTCATGCTATTATGAATGG - Intronic
1189157774 X:38776679-38776701 CTTTTTGATATTATTATAAAGGG - Intergenic
1189191259 X:39108852-39108874 CTTTTTGATGCTATAGTAATTGG + Intergenic
1189196406 X:39157202-39157224 CTATTTGTTGCTACATTCAAAGG - Intergenic
1189527751 X:41842915-41842937 CTTTTTGATGCTGTGGTAAATGG + Intronic
1189567003 X:42252930-42252952 ATTTTTGATGCTATTGTGAATGG - Intergenic
1189596807 X:42575232-42575254 CTTTTTGATGCTCTTATAAATGG + Intergenic
1190065290 X:47236801-47236823 TTTTTGGATGCTATCATAAATGG - Intronic
1190238834 X:48640518-48640540 CTTTTTGATGCTATTGTAAATGG - Intergenic
1190405518 X:50083034-50083056 TTTTTTCTTGCTATAATTAAGGG + Intronic
1190451997 X:50591641-50591663 CTTTTTGATGCTATTGTAAATGG + Exonic
1190485650 X:50921651-50921673 ATTTTTGATGATATTATAAATGG + Intergenic
1190490469 X:50977945-50977967 CTTTTTGATGCTATTATAAGTGG - Intergenic
1190500454 X:51072036-51072058 CTTTTGGATGCTATTTTAAATGG - Intergenic
1190884224 X:54517132-54517154 TTTTTTGTTGCTCTAATAAATGG - Intergenic
1190922331 X:54866056-54866078 TTTTTTGATGCTATCATACATGG + Intergenic
1190993252 X:55575663-55575685 CTTTTTGATACTATCATAAATGG - Intergenic
1191040616 X:56075190-56075212 CTTTTTGATGCTATTGTAAAAGG + Intergenic
1191708748 X:64124002-64124024 TTTTTTGTTGCTATAATAAATGG - Intergenic
1191767710 X:64717568-64717590 TTTTTTGTTGCTATTATAAATGG - Intergenic
1191790180 X:64962783-64962805 CTTTTTGGTGCTATCATAAGTGG - Intronic
1192279211 X:69666055-69666077 GTTTTCGATGCTATCATAAATGG + Intronic
1192281386 X:69689913-69689935 TATTTTGATGCTATTATAAATGG + Intronic
1192303406 X:69930910-69930932 ATTTTTGATGCTATTAAGAATGG - Intronic
1192375488 X:70556815-70556837 CCTTTTGATGCTATTGTAAATGG - Intronic
1192375511 X:70557136-70557158 CTTTTTGATGCTGTTATAAAGGG - Intronic
1192386423 X:70676168-70676190 CTTTTGGCTGCTATAAACATGGG + Intronic
1192413459 X:70955325-70955347 CTTTTTGATGCTGTTATGAATGG - Intergenic
1192456074 X:71277020-71277042 CTTTCTGATGCTATTATAAATGG + Intergenic
1192540076 X:71961130-71961152 CTTTTTGATGCTATTGTAAGTGG + Intergenic
1192617137 X:72637984-72638006 CTTTTTGATGCTATTATAAATGG + Intronic
1192769737 X:74176141-74176163 TTTTTTGATACTATTATAAATGG - Intergenic
1192801952 X:74474316-74474338 CTTTTTGATGCTTTTGTAAATGG + Intronic
1192849967 X:74944345-74944367 ATTTTTGGTGCTATTATAAATGG + Intergenic
1192866289 X:75136237-75136259 CTTTTTGTTGCTATTGTGAATGG - Intronic
1192886479 X:75340103-75340125 CTTTTTGATGCTATTGTAAATGG + Intergenic
1193065130 X:77251287-77251309 CTTTTTGATGCTGTTGTAAATGG - Intergenic
1193117721 X:77791490-77791512 CTATTTGATACTATAGTAAATGG - Intergenic
1193355658 X:80517703-80517725 CTTTTTGAGGCTATTGTGAATGG - Intergenic
1193368418 X:80662421-80662443 CTTTTTGATGCTATTGTAAAGGG + Intergenic
1193390156 X:80916768-80916790 ATTTTTGATGCAATTATAAATGG - Intergenic
1193435398 X:81469312-81469334 ATTTTTGATGCTATTATAAATGG - Intergenic
1193562932 X:83042236-83042258 CTTTTTGATGCTATTGCAAATGG - Intergenic
1193697939 X:84731445-84731467 CTTTCTGATGCTATTCTAAATGG + Intergenic
1193723034 X:85008998-85009020 CTTTCTGATGCTATTTTAAATGG + Intronic
1193741040 X:85217273-85217295 CTTTTGGTGGCTATAATTAAGGG - Intergenic
1194011210 X:88564821-88564843 TTTTATGATGCTATTATAAAAGG - Intergenic
1194070032 X:89311196-89311218 CTTTTTGATGCTATTGTAAATGG + Intergenic
1194073551 X:89359459-89359481 CTTTTTGATGCTATCGTAAATGG + Intergenic
1194126557 X:90025147-90025169 CTTTTTGTGGCTATCATGAATGG - Intergenic
1194171144 X:90584200-90584222 CTTTTTGATGCTATATTTTAAGG - Intergenic
1194251672 X:91583639-91583661 TTTTTTGTTGCTATTATAAATGG + Intergenic
1194354678 X:92867829-92867851 CTTTTTCATGTTTTAATCCATGG - Intergenic
1194440414 X:93926049-93926071 CCTTTTGATGATATAGTAAATGG - Intergenic
1194623311 X:96199254-96199276 CTTTTTGATGCTGTTGTAAATGG - Intergenic
1194873077 X:99157092-99157114 ATTTTTGTGGCTATTATCAATGG - Intergenic
1194910402 X:99635514-99635536 ATTTTTGATGCTGTTATAAATGG - Intergenic
1194983850 X:100468785-100468807 TTTTTTGATGCTATTATAAATGG + Intergenic
1195021805 X:100835862-100835884 CTTTTTGAAGCTTTAATCTGAGG - Intronic
1195133599 X:101879806-101879828 CATTTTGGTGATATAATCAAGGG + Intergenic
1195303122 X:103551506-103551528 CTTTTTGATGCTATTATAAATGG - Intergenic
1195304579 X:103567760-103567782 CTTTTTGATGCTATTGAAAATGG - Intergenic
1195334761 X:103841289-103841311 CCTTTTGATGCTATTATAAATGG - Intergenic
1195556328 X:106229001-106229023 CTTTTTGATGCTATTGTAAATGG + Intergenic
1195566908 X:106349885-106349907 CTTTTTGATGCTACTGTAAAGGG - Intergenic
1196019681 X:110977648-110977670 TTTTTTGATGCTATTGTAAATGG + Intronic
1196076301 X:111580534-111580556 CTTTTTGGTGCTATTGTTAATGG + Intergenic
1196100326 X:111840998-111841020 CTTCCTGATGCTATTATCACAGG - Intronic
1196129248 X:112136079-112136101 CTTTTTGATACTATTGTAAATGG + Intergenic
1196134437 X:112191995-112192017 ATTTTTGGTGCTATTATAAAGGG + Intergenic
1196316598 X:114233175-114233197 CTTTTGGATGCTATTATAAATGG + Intergenic
1196328637 X:114440005-114440027 ATTTTTGATGCTACAGTAAATGG + Intergenic
1196328858 X:114443487-114443509 CTTTTTGATACTATTGTAAATGG + Intergenic
1196381507 X:115096091-115096113 ATTTTTGATGCTATTGTAAATGG - Intergenic
1196703130 X:118693153-118693175 CTTTTTAATGCTATTGTAAATGG + Intergenic
1196727278 X:118907609-118907631 CTTTTTGTTGCTAATATAAATGG + Intergenic
1196732926 X:118959382-118959404 CTTTTTGATGATATTGTAAATGG - Intergenic
1197027522 X:121772319-121772341 CTTTTTGATGCTATTGTAAATGG + Intergenic
1197042197 X:121950447-121950469 CTTTTTGATGCTATTTTAAAAGG - Intergenic
1197080772 X:122412743-122412765 TTTTTTGATGGTATGTTCAAAGG - Intergenic
1197381742 X:125752211-125752233 ATTTTTGATACTATACTAAATGG - Intergenic
1197740561 X:129889821-129889843 ATTTTTGATGCTATTGTGAATGG - Intergenic
1197938005 X:131760249-131760271 CATTTTGATGCTATTGTAAAGGG + Intergenic
1197939579 X:131775747-131775769 CATTTTGATGCTATTGTAAATGG + Intergenic
1197941073 X:131790893-131790915 TATTTTGATGCTATTATAAATGG + Intergenic
1197948411 X:131866231-131866253 TTTTTTGGTGCTATAGTAAATGG + Intergenic
1197968315 X:132088733-132088755 TTTTTTGATGCTATTGTAAATGG - Intronic
1198308859 X:135409865-135409887 CTTTGTGATGCTATTATAAATGG - Intergenic
1198592979 X:138204566-138204588 CTTTTTGCTGCTATTGTAAATGG + Intergenic
1198628709 X:138609440-138609462 CCTTTTGATGCTATTGTAAATGG + Intergenic
1198652742 X:138881174-138881196 CTTTTAGATGTTATAATAAATGG + Intronic
1198710719 X:139499959-139499981 CTTTTTCATGCTATTGTAAATGG - Intergenic
1198771344 X:140133686-140133708 CTTTTTGATGCTATTGTAAATGG + Intergenic
1199006246 X:142700289-142700311 CTTTGTGATGCCATAATAAATGG + Intergenic
1199276098 X:145944222-145944244 TTTCTTGATGCTATTATAAATGG + Intergenic
1199300071 X:146203103-146203125 CTTTTTGATGCTATCGTAAATGG + Intergenic
1199652656 X:149962269-149962291 CATTTTGATGTTATAAAAAATGG + Intergenic
1199735000 X:150677704-150677726 CTTTTTGATGCCATTGTAAATGG - Intergenic
1199752444 X:150833199-150833221 TTTTTTGATGTTATTATAAATGG - Intronic
1199805202 X:151292919-151292941 CTTTTTGATTCTATTGTAAATGG + Intergenic
1199811133 X:151350443-151350465 GTTTTTGATGCTATTGTAAATGG - Intergenic
1199923485 X:152435911-152435933 CTTTTTGATGCTATTATAAATGG - Intronic
1199940654 X:152624036-152624058 CTTTTTGATGATATTGTAAATGG - Intergenic
1200128060 X:153826774-153826796 CTTTATGATGCTATCATAAATGG - Intronic
1200373537 X:155754833-155754855 CTTTTAGATGCTATTGTAAATGG + Intergenic
1200390219 X:155936855-155936877 CTTTTTGATGCTATCATAAATGG - Intronic
1200517375 Y:4161948-4161970 CTTTTTGATGCTATATTTTAAGG - Intergenic
1200570608 Y:4824872-4824894 TTTTTTGTTGCTATTATAAATGG + Intergenic
1200663040 Y:5984860-5984882 CTTTTTCATGTTTTAATCCATGG - Intergenic
1200724270 Y:6646829-6646851 CTTTTTGATGCTATTGTAAAGGG + Intergenic
1200728932 Y:6711023-6711045 CTTTTTGATGCTATCGTAAATGG + Intergenic
1201373758 Y:13293828-13293850 CTTTTTGTTGCTACTATGAATGG - Intronic
1202344746 Y:23909595-23909617 CTCTTTGAAGCTATTATGAATGG + Intergenic
1202526022 Y:25760488-25760510 CTCTTTGAAGCTATTATGAATGG - Intergenic