ID: 957115567

View in Genome Browser
Species Human (GRCh38)
Location 3:76019973-76019995
Sequence CAGAGAAAACCGAAGCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 3, 2: 6, 3: 24, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957115567_957115573 25 Left 957115567 3:76019973-76019995 CCCACATGCTTCGGTTTTCTCTG 0: 1
1: 3
2: 6
3: 24
4: 193
Right 957115573 3:76020021-76020043 TGTGTATTCCTTGGTAGGATGGG 0: 1
1: 1
2: 0
3: 15
4: 116
957115567_957115571 20 Left 957115567 3:76019973-76019995 CCCACATGCTTCGGTTTTCTCTG 0: 1
1: 3
2: 6
3: 24
4: 193
Right 957115571 3:76020016-76020038 AATACTGTGTATTCCTTGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 160
957115567_957115572 24 Left 957115567 3:76019973-76019995 CCCACATGCTTCGGTTTTCTCTG 0: 1
1: 3
2: 6
3: 24
4: 193
Right 957115572 3:76020020-76020042 CTGTGTATTCCTTGGTAGGATGG 0: 1
1: 0
2: 1
3: 14
4: 157
957115567_957115570 16 Left 957115567 3:76019973-76019995 CCCACATGCTTCGGTTTTCTCTG 0: 1
1: 3
2: 6
3: 24
4: 193
Right 957115570 3:76020012-76020034 TGAGAATACTGTGTATTCCTTGG 0: 6
1: 5
2: 0
3: 17
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957115567 Original CRISPR CAGAGAAAACCGAAGCATGT GGG (reversed) Intronic
900852157 1:5152537-5152559 TAGAGATAACCGAATCATGGAGG + Intergenic
900881843 1:5387989-5388011 CAGAGAACCCCCAAACATGTCGG + Intergenic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
905334858 1:37237868-37237890 CAGATAAAAGCAAAGCATGCTGG - Intergenic
905488981 1:38328844-38328866 CAGAGAAGAGGGAAGGATGTGGG - Intergenic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907514601 1:54985737-54985759 CAGAGAAAAGTAACGCATGTTGG - Intronic
910944402 1:92573898-92573920 CAAAGAAAACCCAAACATTTGGG + Intronic
913651738 1:120920958-120920980 CTAAGCAAACAGAAGCATGTAGG - Intergenic
914169368 1:145208107-145208129 CTAAGCAAACAGAAGCATGTAGG + Intergenic
914524485 1:148452071-148452093 CTAAGCAAACAGAAGCATGTAGG + Intergenic
914599183 1:149183759-149183781 CTAAGCAAACAGAAGCATGTAGG - Intergenic
914641917 1:149615069-149615091 CTAAGCAAACAGAAGCATGTAGG - Intergenic
915171141 1:153977896-153977918 CAGAGAAACCAGAAGCTTGACGG - Intergenic
915687886 1:157653593-157653615 CAGAGGAAACTGAAGCATCAAGG + Intergenic
915932913 1:160070819-160070841 CAGAGAAAGCCGCTGCAGGTGGG - Intergenic
916266306 1:162892897-162892919 CATAGAAAATCGAAGTATGAAGG + Intergenic
916965703 1:169940223-169940245 TTAAGAAAACTGAAGCATGTAGG - Intronic
916985787 1:170190410-170190432 CAGAGAGAATGGAAGCAAGTGGG - Intergenic
917068791 1:171126587-171126609 AAGAGAAAACAGAAACAGGTTGG + Intergenic
917153193 1:171966251-171966273 CAGAGAAAGCTCAAGCCTGTGGG - Intronic
918182126 1:182093504-182093526 CAGAGAAAAACGATGCAGGCCGG + Intergenic
919987115 1:202683086-202683108 CAGAGAATACCAAAACATGGAGG + Intronic
923249901 1:232170221-232170243 GAGAGAAAGCCTAAGCATTTGGG - Intergenic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
1064848871 10:19687471-19687493 CAGAGAAAACCAGTGCAAGTGGG - Intronic
1065742632 10:28811043-28811065 AAGCGAAAACCGAATCAGGTAGG + Intergenic
1070238046 10:74651007-74651029 CAGAGAAAACAGAAGCCATTAGG - Intronic
1071883179 10:89921495-89921517 CAGAGATGACCGAAGCATGTAGG + Intergenic
1075860688 10:125674016-125674038 CAGAGAGAACAGAACCAAGTTGG - Intronic
1076353221 10:129832771-129832793 CACAGGATACAGAAGCATGTGGG - Intergenic
1079432050 11:20400481-20400503 CAAAGAAGACCGATGCATTTCGG - Intronic
1080412332 11:32037582-32037604 CAGTGAAAGCTGAGGCATGTAGG + Intronic
1083329927 11:61892610-61892632 CAAAGAAATCCGAAGCAATTAGG - Intergenic
1086985942 11:93249305-93249327 CAGAGTAAACCACAGTATGTGGG - Intergenic
1091757993 12:3067886-3067908 GAGAGTAAACCCAAGCAGGTAGG - Intergenic
1091837701 12:3597234-3597256 CAGAGAAAGCCCTAGCATGCGGG + Intergenic
1091879618 12:3966509-3966531 CAGAGATAACTGAGGCATTTGGG + Intergenic
1092210770 12:6645120-6645142 CAGGGAAATGGGAAGCATGTTGG - Intronic
1095790966 12:46166656-46166678 CAGAGAAAAGCTGAGTATGTGGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1102004576 12:109581083-109581105 CACAGAAAAGCCTAGCATGTGGG + Intronic
1105680201 13:22718150-22718172 CAGAGAAAACGGAAGCGAGATGG + Intergenic
1106201038 13:27537569-27537591 CAGAGAAACACTAAGTATGTTGG - Intergenic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1109133289 13:58614733-58614755 TATAGAAAAACGAAGCATTTTGG + Intergenic
1110468248 13:75827710-75827732 CAGAAAAAACAGAAACCTGTAGG - Intronic
1111567933 13:90041226-90041248 CAGAGAAAAATGAAACATGAAGG + Intergenic
1112181046 13:97081079-97081101 CAGACAAAACAGAAACAAGTGGG - Intergenic
1112295068 13:98179314-98179336 CAGAGATAACTGAATCATGGGGG - Intronic
1113380326 13:109798191-109798213 TAGAGAAGAGCAAAGCATGTTGG + Intergenic
1113775971 13:112944833-112944855 CAGAGAAAGCCCAGGCAAGTAGG - Intronic
1114177807 14:20339151-20339173 TAGAGAGAACAGAAGCCTGTAGG + Intergenic
1114820782 14:26016952-26016974 AAGAGAAAACAGAAAAATGTAGG + Intergenic
1115374942 14:32664435-32664457 TAGAGAAAACTGAAGAATATTGG + Intronic
1116350375 14:43854783-43854805 CTGAGAAAAAGGAAACATGTAGG - Intergenic
1119598051 14:75954751-75954773 CAGAGAAGACCTAAGCAGTTTGG - Exonic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120124191 14:80720925-80720947 CAGAGAAAACCTAAGTATGAAGG + Intronic
1123427120 15:20181804-20181826 CAGAGAAAAACGATGCATTAAGG - Intergenic
1123536349 15:21188313-21188335 CAGAGAAAAACGATGCATTAAGG - Intergenic
1127443542 15:59036577-59036599 CAGAGATAACTGAATCATGGGGG - Intronic
1130282695 15:82532018-82532040 CAGAGAAAAGGGAAGCCTGACGG - Intergenic
1131466830 15:92662438-92662460 CAAACCAAACCGAACCATGTTGG - Intronic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1136052187 16:27659677-27659699 CAGAGAAAATAGAGGCATGTAGG + Intronic
1136857178 16:33668032-33668054 CAGAGAAAAACGATGCATTAAGG + Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1138061974 16:53901215-53901237 CAGAGAAAAACAAAGAATCTTGG - Intronic
1139445490 16:66995678-66995700 CAAGGAAAACAGATGCATGTGGG + Exonic
1141697256 16:85625962-85625984 CTGAGAAAACACAAGCAGGTGGG - Intronic
1203118750 16_KI270728v1_random:1516523-1516545 CAGAGAAAAACGATGCATTAAGG + Intergenic
1147530346 17:41270634-41270656 CAGAGAGAACCAAAGCAGGTGGG - Intergenic
1153198322 18:2624859-2624881 AAGAGAAAATAGAAGTATGTAGG + Intergenic
1153549291 18:6244501-6244523 CACAGAATACCGATGGATGTCGG + Exonic
1153684417 18:7530951-7530973 CAGAGACAACTGAAACATGGAGG - Intergenic
1155581519 18:27313533-27313555 ATGAGAAAACTGAAGCTTGTTGG + Intergenic
1155808626 18:30205007-30205029 CTGTTAAAACCAAAGCATGTTGG - Intergenic
1155894619 18:31309378-31309400 AAGAGACAACTAAAGCATGTGGG - Intergenic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1158929188 18:62304599-62304621 CAGAGAGAGCTAAAGCATGTTGG + Intronic
1159199692 18:65167912-65167934 CTGGGAAAACGGAAGCAAGTTGG + Intergenic
1159785526 18:72709645-72709667 CAGAGTAAAGCTTAGCATGTTGG + Intergenic
1162450439 19:10751104-10751126 CAGAGAAAAATGAGGCATGGGGG + Intronic
1162896212 19:13765993-13766015 CAGAGACAACCGAAGCATTGGGG + Exonic
925033593 2:670692-670714 CAGAGAAATGTGAAGCCTGTCGG + Intronic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926731070 2:16036116-16036138 CAGACAAAACCCAAGAATTTAGG - Intergenic
926963147 2:18380764-18380786 AAGAGAAAAAGGAACCATGTAGG + Intergenic
930409990 2:51013265-51013287 CAGGGCAAACATAAGCATGTGGG + Intronic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
932551639 2:72775912-72775934 CATAGAAAACTGAATAATGTAGG + Intronic
933210124 2:79556951-79556973 CAGAAAAAATGCAAGCATGTAGG - Intronic
933423834 2:82085831-82085853 CAGAGACAACTGAATCATGGGGG - Intergenic
936927200 2:117749357-117749379 CTGAGAAAACAGAAGCAGCTGGG - Intergenic
938980709 2:136523746-136523768 CAGAGGAAAGGGAAGCATATTGG + Intergenic
940136807 2:150446377-150446399 GAGAGAAAACTGAAGCCTGTGGG - Intergenic
941868194 2:170356259-170356281 CAATGTAAACCGAAGCCTGTTGG - Intronic
943821113 2:192322172-192322194 AAGAGAAAATAGAAGCATGAAGG - Intergenic
945024180 2:205604804-205604826 CAGCGAAAACAGAACCACGTTGG - Intronic
945666870 2:212754320-212754342 CAGAGAGAATGGAAGCAAGTTGG + Intergenic
946364818 2:219242589-219242611 AAGAGAACAAAGAAGCATGTAGG + Intronic
948059765 2:235034129-235034151 CAGACAGGACTGAAGCATGTGGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1172350943 20:34240156-34240178 AAGAGAAAAAAGAAGCATTTGGG + Intronic
1173800930 20:45893981-45894003 GAGAGAAGACCAAAGCCTGTAGG - Exonic
1175819794 20:61902632-61902654 CAGACAAAACAGAAGCGAGTGGG + Intronic
1177748452 21:25250770-25250792 CAGAGAAAACCTCAGGATGAAGG - Intergenic
1179409591 21:41152443-41152465 TAGAGAAAACTGAATCATGGGGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181046123 22:20215135-20215157 GAGAGTAAACTGAGGCATGTGGG + Intergenic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181809091 22:25392585-25392607 CAGAGAAAAGCAAAGCAAGGAGG + Intronic
1182191171 22:28462324-28462346 CAGAGAGAAAAGAAGCATGATGG - Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
950216653 3:11164576-11164598 CAGAGAAAAAGTAAGCATGGAGG - Intronic
951147962 3:19252165-19252187 GAGAGAAAAAAGATGCATGTTGG - Intronic
952053244 3:29412301-29412323 CAGACAAAACCACAGCATCTGGG - Intronic
952187663 3:30988144-30988166 CATAGAAAACAAAAGCATTTGGG - Intergenic
953486019 3:43296887-43296909 CAGAAGCAACTGAAGCATGTGGG - Intronic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
957115438 3:76018713-76018735 CAGAGAGAAACTAACCATGTGGG - Intronic
957115448 3:76018803-76018825 CAGAGAAAAACTAACCATGTTGG - Intronic
957115458 3:76018893-76018915 CAGAGAAAACCGAACCATGTGGG - Intronic
957115467 3:76018983-76019005 CAAAGAAAACCTAACCATTTGGG - Intronic
957115478 3:76019073-76019095 CAGAGAAAACCAAACCATGTGGG - Intronic
957115486 3:76019163-76019185 CAGAGAAAACCTAACCATGTGGG - Intronic
957115493 3:76019253-76019275 CAGAGAAAACTTAACCATGTAGG - Intronic
957115503 3:76019343-76019365 CAGAGAAAACCGAACCATGTGGG - Intronic
957115512 3:76019433-76019455 CAGAGAAAACCAAAGCATGTGGG - Intronic
957115521 3:76019523-76019545 CAGAGAAAACTGAACCATGTGGG - Intronic
957115538 3:76019703-76019725 CAGAGAAAACCTAACCATGTTGG - Intronic
957115546 3:76019793-76019815 CAGAGAAAACCTAAACATGTGGG - Intronic
957115567 3:76019973-76019995 CAGAGAAAACCGAAGCATGTGGG - Intronic
957194667 3:77052040-77052062 AAGAGAAAACGGAAGAATCTGGG - Intronic
957583762 3:82109484-82109506 CAGAGAAAATGGAACCAAGTTGG - Intergenic
958466024 3:94459798-94459820 CTGAGAAAACTTAAGCAGGTAGG - Intergenic
959139944 3:102473467-102473489 CTGAGAAAACTCTAGCATGTTGG - Intronic
959147962 3:102572383-102572405 CAGTTAGAACCGAAGCCTGTTGG - Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
965382606 3:168008537-168008559 TACAGAAAACAGAAGCAGGTGGG + Intergenic
967964317 3:194949110-194949132 CAGAAGAAACCAAAGCAGGTTGG + Intergenic
968010211 3:195269602-195269624 CAGAGACTCCCGAAGCCTGTAGG + Intronic
968892439 4:3376754-3376776 CAGAGAGCACCCCAGCATGTGGG + Intronic
969188151 4:5495174-5495196 CAGGGAAAACGGAACCAAGTTGG - Intronic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970961956 4:21882584-21882606 AAGAAGAAACGGAAGCATGTAGG + Intronic
972032700 4:34481511-34481533 ATGAGAAAACTGAGGCATGTAGG + Intergenic
975804176 4:78095762-78095784 CAGAGATAACTGAATCATGGGGG - Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976761702 4:88556172-88556194 CAGTGAAAAATGAAGCATCTGGG + Intronic
976964579 4:91020806-91020828 CAGAGAAAACAGAAGTACCTTGG - Intronic
977565211 4:98573839-98573861 CAGGGAACACTGAAGCATTTAGG + Intronic
979053821 4:115971039-115971061 CACAAAAAACCCAAGCATGGTGG + Intergenic
983045252 4:162979528-162979550 CAAAGAAAAATGAAGCATATTGG - Intergenic
986220319 5:5763217-5763239 CAGAGAACAAGGAAGCCTGTTGG - Intergenic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
989946935 5:50247218-50247240 CAGAAAAATTAGAAGCATGTTGG - Intergenic
990830187 5:59947555-59947577 AAGAGAAAACTGAAACTTGTAGG + Intronic
991598954 5:68333548-68333570 CCAAGAAAACTGGAGCATGTAGG + Intergenic
992725535 5:79603466-79603488 CAGACATAACAGAAGCATGTTGG + Intergenic
992827266 5:80562771-80562793 CAGAAAGAACCTAAACATGTGGG - Intronic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
997972370 5:138414123-138414145 CATATAAAATGGAAGCATGTAGG - Intronic
1000970961 5:167714249-167714271 CAAAGAAAACCGCACCATGGGGG - Intronic
1002518382 5:179775707-179775729 CAGAGAAAACTGCAGAAGGTGGG - Exonic
1002690753 5:181048342-181048364 CACAGAGAACAGAAGAATGTCGG + Intronic
1004601417 6:17153970-17153992 CAGAGAAAGCAGAAGCGTTTGGG - Intergenic
1004893164 6:20121443-20121465 CAAAGAAAAGGGAAGCATGGGGG + Intronic
1008383079 6:50855695-50855717 TAGAGAAAACTGAATCATGGGGG + Intergenic
1008439110 6:51512027-51512049 CCTAGAAAACAGAAGCATTTAGG + Intergenic
1008955199 6:57208173-57208195 CAGATAAATCCAAATCATGTGGG - Intronic
1009985081 6:70772126-70772148 CATAGAAAACCCAAGTAGGTAGG + Intronic
1010386525 6:75286389-75286411 AAGAGCAAACCCAAGCAAGTCGG - Intergenic
1010568053 6:77442053-77442075 CAGTTAAAAAAGAAGCATGTTGG + Intergenic
1011476881 6:87757019-87757041 CACAGAAAGCAGAAGCTTGTGGG + Intergenic
1013669904 6:112389490-112389512 CAGAGAACAAAAAAGCATGTGGG - Intergenic
1014252113 6:119126278-119126300 AAGAGAAATTCGAAGCATGAGGG - Intronic
1014670874 6:124302058-124302080 CAGAGATAACTGAATCATGGGGG + Intronic
1016494543 6:144645468-144645490 CAGAGAAAACACAAACATTTAGG + Intronic
1018162508 6:161059942-161059964 CACAGAAAATAGAAACATGTGGG - Intronic
1018542972 6:164903167-164903189 CAGAGAAGAAATAAGCATGTGGG - Intergenic
1020522427 7:9208841-9208863 CAGAGAAAGGCGGAGCAAGTTGG - Intergenic
1021690045 7:23222700-23222722 CAGAGAAAACGGATGCAGCTAGG + Intergenic
1022319257 7:29273091-29273113 GAGAGAAAACGGAAAGATGTAGG - Intronic
1031469150 7:122148182-122148204 GAGAGAAAACCAAAGTAGGTGGG - Intergenic
1031592294 7:123608581-123608603 AAGAGAAATCCTAAGCATGATGG - Exonic
1034242106 7:149618505-149618527 AAGGGAAAACCAAAGCAGGTGGG + Intergenic
1036987686 8:13554903-13554925 GAGTGAAAACCCAATCATGTAGG - Intergenic
1038306945 8:26413496-26413518 CAGAGGAAACTGAAAAATGTAGG + Intronic
1039350265 8:36756538-36756560 CAGAGATAACTGAATCATGGAGG + Intergenic
1039719048 8:40142795-40142817 CAGGGAGAACGGAATCATGTTGG - Intergenic
1043080728 8:75761529-75761551 GAGAGAAAACTGAATCATGGAGG + Intergenic
1044179418 8:89169977-89169999 CACAGAAAACCTAAACAGGTAGG + Intergenic
1047803325 8:128332513-128332535 CTGACAAAACTGAAGGATGTAGG - Intergenic
1048480935 8:134792289-134792311 CAGTGAAAACAGAACCATCTAGG - Intergenic
1050275682 9:3996316-3996338 CAGAGAAAACAGAAAAATATGGG + Intronic
1050444966 9:5711355-5711377 CAGACAAAACAGAAGCATTTAGG - Intronic
1053884447 9:42632446-42632468 CAGAAAATACGGAAGCATCTAGG - Intergenic
1053888220 9:42661796-42661818 CAGAAAATACGGAAGCATCTAGG + Intergenic
1054227239 9:62469246-62469268 CAGAAAATACGGAAGCATCTAGG + Intergenic
1055118240 9:72628226-72628248 AAGGGAAAACTGTAGCATGTGGG + Intronic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1058435489 9:104958632-104958654 AAGGGAAAACCAATGCATGTGGG - Intergenic
1059355670 9:113697678-113697700 CAGAGAACATCGAGGCAAGTAGG - Intergenic
1062706455 9:137946726-137946748 CAGAGAGCACCTAAGCATGGAGG - Intronic
1187171763 X:16858985-16859007 TAGAGAAAACCCAAAAATGTGGG + Intronic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1189085719 X:38021508-38021530 CAGGGAAAACCAATGCATGTTGG + Intronic
1189590794 X:42508559-42508581 CAGGGAAAACAGAACCATGTTGG + Intergenic
1194102853 X:89728582-89728604 TAGAGAAAACTGCAGCAAGTAGG + Intergenic
1194730720 X:97450757-97450779 CACAGAAAAGCATAGCATGTAGG - Intronic
1195751665 X:108165572-108165594 CAGAGAAAATGGAAGCAGTTAGG + Intronic
1195898707 X:109774629-109774651 TAGAGAATAGCTAAGCATGTAGG - Intergenic
1199173220 X:144756229-144756251 CAGGGAGAACCGAACCAAGTTGG - Intergenic
1199880066 X:151967106-151967128 GAAAGCAAACCGAAGCATCTTGG + Intronic
1200455534 Y:3386572-3386594 TAGAGAAAACTGCAGCAAGTAGG + Intergenic