ID: 957116576

View in Genome Browser
Species Human (GRCh38)
Location 3:76034555-76034577
Sequence TCTAACACACAGAACTAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957116576_957116580 -8 Left 957116576 3:76034555-76034577 CCACATTAGTTCTGTGTGTTAGA 0: 1
1: 0
2: 1
3: 14
4: 174
Right 957116580 3:76034570-76034592 GTGTTAGAATGTTTTTGTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 279
957116576_957116578 -10 Left 957116576 3:76034555-76034577 CCACATTAGTTCTGTGTGTTAGA 0: 1
1: 0
2: 1
3: 14
4: 174
Right 957116578 3:76034568-76034590 GTGTGTTAGAATGTTTTTGTGGG 0: 1
1: 0
2: 2
3: 28
4: 389
957116576_957116579 -9 Left 957116576 3:76034555-76034577 CCACATTAGTTCTGTGTGTTAGA 0: 1
1: 0
2: 1
3: 14
4: 174
Right 957116579 3:76034569-76034591 TGTGTTAGAATGTTTTTGTGGGG 0: 1
1: 0
2: 1
3: 40
4: 489
957116576_957116581 -4 Left 957116576 3:76034555-76034577 CCACATTAGTTCTGTGTGTTAGA 0: 1
1: 0
2: 1
3: 14
4: 174
Right 957116581 3:76034574-76034596 TAGAATGTTTTTGTGGGGGTAGG 0: 1
1: 0
2: 3
3: 42
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957116576 Original CRISPR TCTAACACACAGAACTAATG TGG (reversed) Intronic
901440316 1:9273643-9273665 TCAGACAAACAGAACTCATGAGG - Intergenic
908016159 1:59838962-59838984 CCTGACACACACAAGTAATGGGG - Intronic
909968777 1:81953690-81953712 TCTATCACACAGAACCACTATGG - Intronic
910647892 1:89532790-89532812 CCTACCTCACAGAACAAATGAGG + Intronic
911086567 1:93982987-93983009 TGTAATACACAGAACTTATAAGG - Intergenic
911527896 1:99007368-99007390 TCTAAAACAGACAAATAATGGGG - Intergenic
911643025 1:100308980-100309002 TCAAATATAGAGAACTAATGGGG + Intergenic
919133207 1:193476635-193476657 ACTAACACACAGAAGCAATTAGG - Intergenic
1062809487 10:451789-451811 TCTAACACAAAGCAATCATGTGG + Intronic
1064133163 10:12728156-12728178 TCTAACACACATGACAAATCTGG - Intronic
1064601875 10:17001975-17001997 TCTCACAAACAGAACAAATCTGG - Intronic
1066393213 10:34995454-34995476 TCTAACCCAGAGAACTGAGGTGG + Intergenic
1068389781 10:56380122-56380144 TGCAACACACTGTACTAATGTGG + Intergenic
1071467394 10:85953909-85953931 TCTACCACAGAGAGGTAATGAGG - Intronic
1073661784 10:105483662-105483684 TCTAATATCCAGAATTAATGAGG - Intergenic
1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG + Intronic
1076555405 10:131318087-131318109 TCTAAGAAGCAGAACAAATGAGG - Intergenic
1078602041 11:12741676-12741698 TCTCCAACACAGAACTAATAAGG - Intronic
1078654154 11:13222522-13222544 TCTGACTCACAGAACAAAAGAGG + Intergenic
1079595192 11:22235873-22235895 TCTGGCACAAAGAACTAAAGAGG + Intronic
1081310463 11:41564527-41564549 CCTAACATACAAATCTAATGAGG - Intergenic
1087332815 11:96803520-96803542 TCTAAAACACACAACTAACGGGG + Intergenic
1087551334 11:99654222-99654244 TCTAATACACACAGCTACTGTGG - Intronic
1087804758 11:102543868-102543890 TGTATCACACAGAACTTATTTGG - Intergenic
1087926865 11:103928991-103929013 TCTAACACGGAGGACTAAAGAGG + Intronic
1088687214 11:112295022-112295044 TCTAACAAACAGAACTGATGGGG + Intergenic
1091683864 12:2547611-2547633 GCACACACACAGAACTACTGCGG - Intronic
1092078730 12:5695153-5695175 TCTAACACAAAAATTTAATGAGG - Intronic
1093293057 12:17352970-17352992 TATAACACACACAAATAAGGAGG + Intergenic
1098179023 12:67826004-67826026 TTTATGACCCAGAACTAATGAGG + Intergenic
1098928027 12:76374795-76374817 TTTGACTCACAGAACTCATGAGG + Intronic
1099031282 12:77528614-77528636 CCTAACACACACAAGCAATGGGG + Intergenic
1099167799 12:79328051-79328073 TCTTACACACAGAGCTGATGTGG - Intronic
1100659794 12:96684417-96684439 TCTAACAGATAGTAATAATGGGG - Intronic
1102143634 12:110637576-110637598 TGTAACACACAGACTGAATGTGG + Intronic
1106542896 13:30705744-30705766 CCTGACACTCTGAACTAATGTGG + Intergenic
1110370427 13:74733689-74733711 TCTAACACCCAGAAATGATTTGG + Intergenic
1111329914 13:86751797-86751819 TCTAACATACAGAATTTATAAGG - Intergenic
1111874571 13:93877450-93877472 TATAACACACAACACAAATGAGG + Intronic
1112989737 13:105497640-105497662 TCTAAAACACAGAAGTGAAGAGG + Intergenic
1113364188 13:109661245-109661267 TCTACCACACCGAGCTATTGCGG - Intergenic
1113883579 13:113644666-113644688 ACTAAAAAACAGAACTAATAAGG + Intergenic
1118557549 14:67042493-67042515 CCTGACACACACAAGTAATGGGG - Intronic
1127278542 15:57469064-57469086 ACTAATACAGAGACCTAATGTGG + Intronic
1129911962 15:79235192-79235214 TCTACCTCACAGAATTCATGTGG + Intergenic
1131470967 15:92696702-92696724 TCTATCAGAGAGATCTAATGAGG + Intronic
1132202074 15:99961962-99961984 CCCCACACACAGAACTCATGTGG - Intergenic
1137783780 16:51120457-51120479 TCTAAGACACAGAAGTGATTTGG - Intergenic
1141405559 16:83789771-83789793 TCTAAGACACAGACCAAATCTGG + Intronic
1143860661 17:9888296-9888318 GCTAACTCACAGAACTCCTGAGG - Intronic
1146271105 17:31486602-31486624 TCTAACACACAGGAGCACTGTGG - Intronic
1148981479 17:51579534-51579556 CCTGACACACATAAGTAATGGGG + Intergenic
1149436945 17:56641057-56641079 CTTAACTCACAGAGCTAATGAGG - Intergenic
1150116253 17:62552507-62552529 TATAATACACACAAATAATGAGG - Intronic
1152444751 17:80335282-80335304 TCTAAGCCACAGAACTGAAGAGG - Intronic
1156265176 18:35481500-35481522 TCCAACAGGCAGAAGTAATGTGG - Intronic
1158060676 18:53336882-53336904 TCAAACACACAAAACTAATTAGG + Intronic
1158514160 18:58117384-58117406 ATTAACACACAGAAGCAATGTGG - Intronic
1158632483 18:59127933-59127955 TTTAAAAGACAGAACTACTGAGG - Intergenic
1159112922 18:64081237-64081259 TCTATCACAGACTACTAATGTGG + Intergenic
1161350859 19:3790741-3790763 TCTCCCACACACAACTCATGTGG + Intronic
1161730294 19:5956302-5956324 TCTAACACACCCAACTCCTGAGG + Intronic
1163292828 19:16391869-16391891 TGTAACACACAGCACTGGTGGGG - Intronic
1165698134 19:37916643-37916665 TCTAACAGACAGCACTGTTGTGG - Intronic
1165797951 19:38529686-38529708 TCCAACAGACAGAAGTAGTGGGG + Intronic
1166493941 19:43284460-43284482 TTTGACACACAGAACTGCTGTGG - Intergenic
1167899967 19:52613009-52613031 TCTAACACATGTAATTAATGTGG - Exonic
925094772 2:1187588-1187610 TCTGAGAAACAGAACCAATGAGG - Intronic
925278087 2:2664609-2664631 TCTCACACACAGAACACAGGAGG + Intergenic
926881897 2:17554581-17554603 TCTAACAACCAGAACTAAAGAGG + Intronic
929267592 2:39936604-39936626 TCTAACATACAGAATTTATCAGG + Intergenic
930411977 2:51035663-51035685 GCTACCACTCAGAACAAATGAGG + Intergenic
930895733 2:56443794-56443816 TATAACACACAGACCAAATTGGG - Intergenic
930913027 2:56653119-56653141 TCCACCAAACAGAAGTAATGGGG - Intergenic
931072166 2:58664601-58664623 TATCACACACAAAACTAGTGGGG - Intergenic
933600963 2:84329708-84329730 TGAAACACACAGAACAATTGTGG + Intergenic
934803401 2:97191826-97191848 GCTAACAAACAGGAGTAATGAGG - Intronic
935109766 2:100081683-100081705 TCTGACACACAGAATCATTGGGG + Intronic
935917968 2:107978342-107978364 TCTGACACACACAAGCAATGGGG + Intergenic
936125209 2:109783526-109783548 TCTGACACACAGAACCATTGGGG - Intergenic
936219484 2:110587942-110587964 TCTGACACACAGAACCATTGGGG + Intergenic
937350653 2:121158699-121158721 TCAAACACACACAAAAAATGTGG - Intergenic
939050667 2:137303483-137303505 TTTAATAAACAGAATTAATGTGG + Intronic
940500640 2:154489422-154489444 ACTTACACACAAAACTCATGAGG - Intergenic
941553758 2:166949284-166949306 TTAAGGACACAGAACTAATGGGG - Intronic
942041155 2:172064206-172064228 TCAAGCACACAGAAATAATGTGG - Intronic
942477831 2:176347459-176347481 TAAAACACACAGAAATATTGTGG - Intergenic
942698866 2:178680180-178680202 TTTCACACACAGAACTGAAGAGG + Intronic
945237465 2:207644834-207644856 TATAATACAAAGAACAAATGAGG + Intergenic
945635034 2:212338295-212338317 TCTAAGACCCAGCACTACTGTGG + Intronic
945794360 2:214343390-214343412 TTTAACACACATGAGTAATGAGG + Intronic
946281804 2:218671474-218671496 TCTCTCACACAGCACTAGTGAGG - Intronic
948706280 2:239795172-239795194 ACTAAAACACAGACCTAAAGGGG - Intronic
1168790728 20:574170-574192 TGGAACACACAGTCCTAATGTGG - Intergenic
1173784095 20:45779983-45780005 TCTAACACCTGGAATTAATGGGG + Intronic
1177258885 21:18702534-18702556 TCAAACACACAGAAAGAATCTGG + Intergenic
1179123037 21:38566453-38566475 TCTAAAACACTCAACTACTGGGG + Intronic
1182916728 22:34040168-34040190 TCTGATACACAGAATTAATAAGG - Intergenic
950171190 3:10840062-10840084 TCTAAAACACACATCTGATGGGG + Intronic
954457150 3:50605962-50605984 CCTGACACACAGAACTGAAGAGG - Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956849630 3:73217160-73217182 TCTACAATACAGACCTAATGAGG + Intergenic
957116576 3:76034555-76034577 TCTAACACACAGAACTAATGTGG - Intronic
958801398 3:98760252-98760274 TCAAACACACAGATCACATGGGG + Intronic
960136427 3:114110372-114110394 TCTACTTCACAGAACTATTGGGG - Intergenic
961047130 3:123716893-123716915 TGTAACACAAAGAACCCATGTGG + Intronic
961723726 3:128912266-128912288 TCTAACCCCCAGATCTCATGGGG - Intronic
969302414 4:6304898-6304920 TGTAAAACCCAGAACAAATGTGG - Intergenic
971073394 4:23120796-23120818 TCTAACACACAGATCTTAAATGG - Intergenic
971566563 4:28150775-28150797 CCTAACATAGAGAACTACTGTGG - Intergenic
972181399 4:36471116-36471138 TCTCACACAAAGAGCCAATGTGG + Intergenic
973839927 4:54850915-54850937 TGAAACACACAGAACTGATCTGG - Intergenic
981023520 4:140053006-140053028 CCTAACAGACAGCACTTATGAGG + Intronic
981571248 4:146152882-146152904 TGTAAGACACATGACTAATGTGG + Intergenic
988304313 5:29475043-29475065 TCTAAAACAAATAACTAATTGGG + Intergenic
988351155 5:30108744-30108766 TCTAATTCATAGAACTGATGAGG - Intergenic
988384359 5:30541069-30541091 TCTAACACAGAGAAGAAATTAGG + Intergenic
988441396 5:31237676-31237698 TCACACACAAAGAAATAATGGGG - Intronic
993982425 5:94558552-94558574 TTTAACACAAAAAACTACTGTGG - Intronic
994009794 5:94888290-94888312 TTTAAGAGACAAAACTAATGTGG + Intronic
994557457 5:101321532-101321554 TCTAACACACAAAAATTGTGAGG + Intergenic
995642538 5:114274104-114274126 CCTAACACACACAAGCAATGGGG - Intergenic
996323650 5:122248077-122248099 CCTGACACACAGAAGCAATGTGG - Intergenic
997419368 5:133753672-133753694 ACACACACACAGAACAAATGTGG - Intergenic
997753071 5:136368168-136368190 TATAAAACACAGAAGTAATTAGG + Intronic
1000429656 5:161136161-161136183 TCAAACACAGAGATATAATGGGG - Intergenic
1001684523 5:173583586-173583608 TCTACCACACAGAACAGATGTGG - Intergenic
1003041266 6:2689614-2689636 TCTAACATACAGAATTACTCAGG + Intronic
1003615260 6:7649366-7649388 ACTAACACACAGAATTTATCTGG + Intergenic
1004985749 6:21080288-21080310 TCTAACAAACATGACTAATCTGG + Intronic
1005009145 6:21319522-21319544 TCTGACACACACAAGCAATGGGG + Intergenic
1005359936 6:25022501-25022523 CGTAACACATATAACTAATGTGG + Intronic
1005778651 6:29165275-29165297 TCTAACCCACTGAACAAATGTGG + Intergenic
1009583967 6:65572798-65572820 TATAAAACATAAAACTAATGGGG - Intronic
1011010295 6:82695861-82695883 TCTGACACACAGAAATGAGGTGG + Intergenic
1011185084 6:84665730-84665752 TCTAAATCACAGATATAATGAGG + Intergenic
1014778834 6:125540428-125540450 TCTAACACACAGGACCAAGGTGG - Intergenic
1015020809 6:128472217-128472239 AATAAAACACAGAATTAATGAGG - Intronic
1015646737 6:135399557-135399579 TCTAACAAATAGCACTGATGAGG - Intronic
1015930986 6:138359740-138359762 AGTAACACACAGAAGGAATGAGG + Intergenic
1017862766 6:158414382-158414404 TCTCCCACACAGAAGTCATGGGG - Intronic
1018467130 6:164058257-164058279 TCTAAAGCAAAGAATTAATGAGG - Intergenic
1019508135 7:1403715-1403737 GCTGACACCCAGAACAAATGGGG - Intergenic
1026074876 7:67156972-67156994 TCTAAGACACAGAAGGAAAGGGG - Intronic
1028189669 7:87831329-87831351 TCTAACACAAAGAATGAATGTGG - Exonic
1028440421 7:90853368-90853390 TCTCACACACAAAGCTACTGAGG - Intronic
1029179073 7:98686220-98686242 TTGAACTCACAGAACTCATGTGG + Intergenic
1031654617 7:124338505-124338527 TCAACCACACAGACCTAATCTGG + Intergenic
1032045987 7:128608313-128608335 TATAATACACACAAATAATGAGG - Intergenic
1032866625 7:135931927-135931949 TCTAACACAAAGAAATGATAAGG - Intronic
1033160813 7:138994919-138994941 TTTAACTCACAGAATTAATTTGG + Intergenic
1033587995 7:142788411-142788433 GCTTACACACAGAACTCTTGGGG - Intergenic
1036165989 8:6434150-6434172 CCTAACACACTGTAGTAATGTGG + Intronic
1037096571 8:14993412-14993434 TATAACACAAAGAAATCATGGGG + Intronic
1045615615 8:103906980-103907002 TCTAGCCCACAGAAAGAATGGGG + Intronic
1046074026 8:109295345-109295367 TCTGAAAAACAGAAGTAATGTGG - Intronic
1046524378 8:115365569-115365591 GCTAACAAACACAAGTAATGGGG - Intergenic
1047032917 8:120902824-120902846 TCTACCACACATAACTTATGAGG + Intergenic
1047295209 8:123564694-123564716 TCTTCCTCACAGAGCTAATGAGG - Intergenic
1053597401 9:39576291-39576313 TCTCACACAGAGAAATCATGAGG - Intergenic
1053855419 9:42333262-42333284 TCTCACACAGAGAAATCATGAGG - Intergenic
1054568863 9:66788708-66788730 TCTCACACAGAGAAATCATGAGG + Intergenic
1057288178 9:93777586-93777608 TCTAACCCACAGAACAGAGGTGG - Intergenic
1057597310 9:96425819-96425841 TCTGACACACAGAAGTGAGGAGG - Intergenic
1058349163 9:104000230-104000252 TCTAACCCACTGAACAAACGTGG - Intergenic
1059150258 9:111943112-111943134 ACAAACACAAAGAACTAAAGGGG - Intergenic
1060804578 9:126566436-126566458 TCTAACACACAGAAAAGAGGAGG - Intergenic
1061228590 9:129297365-129297387 TCTGACACACACAAGCAATGGGG - Intergenic
1186401438 X:9263887-9263909 TCTGAAACTCAGATCTAATGAGG + Intergenic
1187236756 X:17475030-17475052 TCTACAACACAGAAGTAATAAGG + Intronic
1188182808 X:27076173-27076195 TCCAAGTCAGAGAACTAATGTGG + Intergenic
1188473073 X:30561981-30562003 TTTATCATAAAGAACTAATGGGG + Intronic
1190229463 X:48570910-48570932 TCTAACAAAAAGAAGTAATGAGG - Intergenic
1190952174 X:55157146-55157168 TCTAAGAGACAGAACTACTTTGG - Intronic
1190982999 X:55473566-55473588 TCAAACATGCAGAAGTAATGAGG + Intergenic
1190985700 X:55499617-55499639 TCAAACATGCAGAAGTAATGAGG - Intergenic
1191001951 X:55669594-55669616 CCTAACACACACAAGCAATGGGG - Intergenic
1192307779 X:69981528-69981550 TGTAACACACATAAGTAAAGGGG + Intronic
1193397484 X:81003218-81003240 TCTAACCCACCGAACAAACGTGG + Intergenic
1193650103 X:84121529-84121551 TATAAACCACAGAACTTATGGGG - Intronic
1194408149 X:93523754-93523776 TTTTACCCACAGAACTAAGGAGG - Intergenic
1194679246 X:96831565-96831587 TTTAAAACACAGCACTATTGAGG + Intronic
1195579779 X:106488389-106488411 CCTAACACACACAAGCAATGGGG - Intergenic
1197857937 X:130937711-130937733 TCAGAGAAACAGAACTAATGGGG + Intergenic
1197929623 X:131680787-131680809 GCTAACTCACAGAACAGATGTGG - Intergenic
1197945840 X:131839610-131839632 GCTAACTCACAGAACAGATGTGG + Intergenic
1198207773 X:134484336-134484358 TCAAACATACAGAATTGATGGGG - Intronic
1199263786 X:145806421-145806443 TCTAAGCCACAGTAATAATGGGG + Intergenic
1202109041 Y:21402941-21402963 TCTAACATACAGAGCAAAAGGGG + Intergenic
1202467514 Y:25172165-25172187 TCTAACACATAGAGCTACTTGGG - Intergenic