ID: 957118144

View in Genome Browser
Species Human (GRCh38)
Location 3:76054279-76054301
Sequence ATTTAGTTCTTTAGGTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957118144 Original CRISPR ATTTAGTTCTTTAGGTCAGA TGG Intronic
900570376 1:3355334-3355356 AATTAATTCGTGAGGTCAGATGG - Intronic
901950726 1:12743816-12743838 ATTTGGTTCTTTATGTCAAAAGG - Intergenic
903439072 1:23373741-23373763 ACCTAGTTCATGAGGTCAGAGGG + Intergenic
903794309 1:25917135-25917157 ACTTAGGGCTTAAGGTCAGATGG + Intergenic
907217870 1:52881456-52881478 ATGTTGTTCTACAGGTCAGATGG - Exonic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
911724529 1:101228651-101228673 TTTTTTTTCTTTATGTCAGATGG + Intergenic
911783761 1:101918329-101918351 CTTAAGTTGTTTTGGTCAGAAGG + Intronic
912677977 1:111703595-111703617 ATTTTTTTCTTTTGGTCACAGGG - Intronic
913570515 1:120115268-120115290 ATTTATTTCTTTATTTGAGACGG - Intergenic
914291322 1:146276247-146276269 ATTTATTTCTTTATTTGAGACGG - Intergenic
914552366 1:148727030-148727052 ATTTATTTCTTTATTTGAGACGG - Intergenic
914764621 1:150627063-150627085 ATTTATTTCTGTAGGAGAGATGG + Intronic
915350901 1:155225079-155225101 ATTTATTTTTTTAGGTGACAGGG - Intergenic
915734166 1:158074270-158074292 ATTTAGGTCTTTGGGTCTGCAGG - Intronic
916086342 1:161272737-161272759 ATTTACTTCTTAAGGAGAGAGGG + Intronic
916432312 1:164742719-164742741 ATTTCATTTTTTAAGTCAGAGGG - Intronic
916607904 1:166361206-166361228 ATTTCTTTCTTTGGGACAGAAGG - Intergenic
917200207 1:172506836-172506858 ATCTGGTTATTTAGGTCAGAAGG + Intergenic
924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG + Intronic
924748443 1:246860901-246860923 ATTTGTTTCTGTAGGTCTGAAGG + Exonic
1063041890 10:2349672-2349694 GTTTAGTTTTTGAAGTCAGATGG + Intergenic
1063847482 10:10146938-10146960 ATTCAGTTCTTCTGGTTAGAAGG - Intergenic
1064660204 10:17600342-17600364 ATTTATTTATTTATGTGAGACGG + Intronic
1066034024 10:31462532-31462554 CTTTAGTTCTTAAGGACCGATGG + Intronic
1068154348 10:53177788-53177810 ATTTTTTTCTTGATGTCAGAGGG + Intergenic
1071263266 10:83940376-83940398 ATCCAGATCTCTAGGTCAGAGGG - Intergenic
1075116991 10:119635110-119635132 AGTTAGTTCTCTAGGCCAGGTGG - Intergenic
1076548051 10:131259376-131259398 TTTTAGTTCTTCATGTGAGATGG - Intronic
1079540990 11:21574354-21574376 ATTTAGTTCTCTGGGACTGAAGG - Intronic
1081158663 11:39727024-39727046 ATTTAGGTCTTCAGTTCTGAAGG - Intergenic
1082715123 11:56602763-56602785 ATTTCCATCTTTAGGTCTGAAGG - Intergenic
1084990013 11:72914019-72914041 ATTTATTTATTTATTTCAGAAGG + Intronic
1085376582 11:76067966-76067988 ACTTAGATCCTAAGGTCAGAAGG + Intronic
1085466684 11:76728745-76728767 TTTTTGTTCTTTAGGAGAGAGGG + Intergenic
1087790455 11:102400961-102400983 ATGTAGCTCTATAGGTCTGATGG - Intronic
1088266992 11:107997374-107997396 TTATAGTTCTGGAGGTCAGAAGG - Intergenic
1089279830 11:117366063-117366085 ATTTAGTTCTTTTTGTCACATGG + Intronic
1092887059 12:12934084-12934106 ATTTGGCTCTTTATGTCAAAAGG + Intergenic
1093016211 12:14156924-14156946 ATTTCTTTCTTTAGGTCAACAGG - Intergenic
1093740547 12:22680406-22680428 ATTTCATTCTGTAGGTCACAGGG - Intronic
1094146644 12:27235618-27235640 ATTTTGTTCTTTAGGTCCAAAGG - Intergenic
1095459962 12:42433257-42433279 ATTTATTTTTTTATATCAGATGG + Intronic
1095667709 12:44821459-44821481 TTTTAGTTCTTTAAGTAAGTAGG + Intronic
1095857959 12:46882000-46882022 ATTGAGTTCTTTTGGGGAGAAGG - Intergenic
1095927553 12:47594104-47594126 ATTTTTTTCTTTGGTTCAGAAGG - Intergenic
1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG + Intronic
1099808867 12:87555181-87555203 ATTTATTTCTGTTGGTGAGATGG - Intergenic
1099852615 12:88121515-88121537 ATTTAGTTCTTTATTTCAAATGG - Intronic
1102978270 12:117222085-117222107 ACTTTTTTCTTTACGTCAGATGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105064907 12:133188141-133188163 ATGGAGATCCTTAGGTCAGAGGG + Intronic
1105779430 13:23694113-23694135 ATTTAGATCTTTAATTCACAGGG - Intergenic
1107943968 13:45400413-45400435 ATTTATTTATTTATGTGAGACGG - Intronic
1108837585 13:54571194-54571216 ATTTGGGTCTTGAGCTCAGAGGG + Intergenic
1109321822 13:60819229-60819251 ATGTTGTTCTTTGGGTCACAAGG + Intergenic
1110658250 13:78026263-78026285 TCATAGTTCTGTAGGTCAGAAGG - Intergenic
1110780060 13:79455038-79455060 ATTTTGTTGTTTATGTCAAAAGG + Intergenic
1111651203 13:91092977-91092999 TTTTTGTTCTTGAGGGCAGAGGG - Intergenic
1111926687 13:94470479-94470501 ATTTCATTCCTTAGGTTAGAGGG + Intronic
1112781830 13:102909257-102909279 ATTTATTTCTTTATTTGAGATGG + Intergenic
1113742455 13:112720995-112721017 ATTTGGCTCTTGAAGTCAGAAGG + Intronic
1114793924 14:25690783-25690805 ATTTATTTCATTAGGTTAAATGG + Intergenic
1115383140 14:32762847-32762869 ATTAAGATCTTTAGGTCAAAAGG + Intronic
1116706186 14:48304646-48304668 ATTTGGTTCTTTATGTCAAAAGG + Intergenic
1117257749 14:53997207-53997229 ATGTAGTTTTTGGGGTCAGAAGG + Intergenic
1117359277 14:54957303-54957325 ATTTAGTTCTAAAGATGAGATGG - Intronic
1118353002 14:64987341-64987363 TTCTCGTTCTTTAGGGCAGAGGG - Intronic
1118385054 14:65249204-65249226 ATTTATTTATTTATGTGAGATGG - Intergenic
1118466188 14:66033313-66033335 TTTTACTTCTTTTGGTCATAAGG - Intergenic
1120108141 14:80519829-80519851 ATTGAGTTCTTTAGTGTAGATGG - Intronic
1120812204 14:88815737-88815759 ATTTATTTATTTATTTCAGATGG + Intergenic
1122316624 14:100829149-100829171 GTTTAAGTCTTTAGGTAAGAGGG - Intergenic
1122562216 14:102624189-102624211 ATTTATTTATTTATGTGAGACGG - Intronic
1122710084 14:103650061-103650083 ATTGAGTTCTTTTGGTCTCACGG + Intronic
1123394885 15:19923081-19923103 AATTAATTCTTTATGTTAGACGG + Intergenic
1123672744 15:22676487-22676509 ATTTAATTCTTTAGTCCAGGTGG + Intergenic
1124032260 15:26022354-26022376 ATTTGGGTCTTTATGTCAAAAGG + Intergenic
1124324796 15:28749777-28749799 ATTTAATTCTTTAGTCCAGGTGG + Intergenic
1124528648 15:30482801-30482823 ATTTAATTCTTTAGTCCAGGTGG + Intergenic
1124599093 15:31116596-31116618 ATTTATTTATTTATTTCAGATGG - Intronic
1124770008 15:32524896-32524918 ATTTAATTCTTTAGTCCAGGTGG - Intergenic
1125195767 15:37044268-37044290 ATTTATTTCTTTAGCAGAGAGGG - Intronic
1126839391 15:52701927-52701949 ATTTATTTTTTTAGTTGAGATGG - Intronic
1126984813 15:54293360-54293382 AGTTTGTTCTTTAAATCAGAAGG + Intronic
1129882664 15:79017443-79017465 ATTTAGATCTGTAGGTCTGCAGG + Intronic
1130318751 15:82821388-82821410 ATTTAATTCTTTAGTCCAGGTGG + Intronic
1130894476 15:88159596-88159618 GTCTACTTCTTTAGGGCAGAGGG - Intronic
1131667235 15:94583574-94583596 ATTTAGCTCTACAGTTCAGAGGG + Intergenic
1133792514 16:9020024-9020046 ATTTATTTATTTATGTGAGATGG + Intergenic
1134393407 16:13840593-13840615 ATTTGGCTCTTTACGTCAAAAGG - Intergenic
1136770373 16:32833644-32833666 AATTAGTTCTTTATGTTAGACGG - Intergenic
1136945230 16:34642401-34642423 AATTAATTCTTTATATCAGACGG + Intergenic
1136948171 16:34681548-34681570 AATTAATTCTTTATATCAGACGG + Intergenic
1137408887 16:48211233-48211255 ATACAGTTCTTTAGTTCAGCAGG + Intronic
1138284175 16:55795170-55795192 ATTTTGTTCTTTAGGGGTGAAGG - Intergenic
1138284827 16:55801817-55801839 ATTTTGTTCTTTAGGGGTGAAGG + Intergenic
1140713633 16:77701918-77701940 ATTTAGTTCCTTAGGGCCGAAGG - Intergenic
1203072794 16_KI270728v1_random:1095751-1095773 AATTAGTTCTTTATGTTAGACGG - Intergenic
1144843775 17:18205206-18205228 ATTTCTTTCTTTTGCTCAGATGG + Intronic
1147059884 17:37867035-37867057 ATTTATTTCTTTATTTCAGTAGG - Intergenic
1148544335 17:48505580-48505602 ATCTAGTTATTTTGGTCACAAGG + Intergenic
1149151043 17:53564186-53564208 ATTTATTTATTTATGTGAGACGG - Intergenic
1149650623 17:58273955-58273977 ATTTAGTCCTCTAAGGCAGAGGG - Intronic
1150245605 17:63672519-63672541 ATATAGGTCTCTAGCTCAGAGGG + Intronic
1150982024 17:70153386-70153408 ATTTTGTTCTTTTGTTTAGATGG - Intergenic
1152474269 17:80507726-80507748 ATTTATTTATTTATTTCAGACGG - Intergenic
1153899303 18:9602034-9602056 ATTCAGTTCTATAGGTAACAAGG - Intronic
1155531251 18:26768964-26768986 ATTTATTGCTTTAGGACACACGG - Intergenic
1155797260 18:30055505-30055527 ATTTAATTCTTTAGGTCATTAGG - Intergenic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1156877618 18:42034453-42034475 ATTCAGTTCATTAGTTCAGATGG + Intronic
1157141133 18:45107907-45107929 TTTTAGTGGTTTAGGTGAGACGG - Intergenic
1157732373 18:50015247-50015269 ATGAAGTTCACTAGGTCAGAGGG - Intronic
1158650421 18:59279494-59279516 ATTTAGTTTTTAAGTTGAGAGGG - Intronic
1159838326 18:73368213-73368235 AATTTGTTCTTTATGTGAGATGG - Intergenic
1160554265 18:79715886-79715908 ATTTAGTTTTCTAACTCAGAGGG - Intronic
1162331471 19:10032501-10032523 ATATAGTTCGTGGGGTCAGACGG + Intergenic
1164579620 19:29426398-29426420 ATATATTTCTTTATGCCAGAAGG - Intergenic
1166597717 19:44065004-44065026 ATGTAGGTCTTTAGGTCACAGGG - Intronic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1167005046 19:46770480-46770502 ATTTATTTCTTTATTTGAGACGG + Intronic
1167836284 19:52074147-52074169 ATTTCCTTCTTTAGTACAGATGG - Intronic
1167841275 19:52123059-52123081 ATTTCTTTCTTTAGTACAGATGG - Intronic
1202681493 1_KI270712v1_random:8335-8357 AATTAGTTTTTTATGTTAGACGG + Intergenic
925726028 2:6872475-6872497 ATTAAGCTATTTAGGGCAGAGGG + Intronic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
928104910 2:28463520-28463542 CTTTGATTCTTTAGGCCAGAAGG + Intronic
928244667 2:29616840-29616862 ATTTGGCTCTTTAGGGCAAAAGG - Intronic
932129190 2:69172172-69172194 ATTTAATTGATTAAGTCAGAGGG - Intronic
932129384 2:69174050-69174072 ATTTAGTTGATTAAGCCAGAGGG - Intronic
935366837 2:102302345-102302367 GTTTAGTTATTTAAGTCAGGAGG + Intergenic
936637979 2:114281071-114281093 ATTTTTTTCTTCAGGTCAGATGG + Intergenic
939171514 2:138701558-138701580 ATTTGCTTCTTTGGGTCAGGTGG + Intronic
939625822 2:144476000-144476022 TTTTATTTCCTTATGTCAGAAGG - Intronic
940107921 2:150118775-150118797 ATTTTTTTCTTTAGTACAGACGG - Intergenic
941118705 2:161503550-161503572 ATTTGTTTCTGTAGGTCTGAAGG + Intronic
941837717 2:170044572-170044594 ATTTAGTTCTTTATGTACAAGGG + Intronic
941854569 2:170217770-170217792 ATATAGTTCTGTAGGCCAGTTGG - Intronic
942286772 2:174426234-174426256 ATTTAGTTCTTTAGTCCATCTGG + Intronic
942758623 2:179371562-179371584 ATTTAGGTTTTTAACTCAGAAGG + Intergenic
943951798 2:194138594-194138616 ATTTAGTAATTTAGGACTGATGG + Intergenic
944490310 2:200251908-200251930 ATTTTGTTCTTAAAGTCAGAAGG - Intergenic
945579600 2:211576797-211576819 ATTCAGTTTTTTAAGTTAGAAGG - Intronic
945861033 2:215122700-215122722 TTTCCCTTCTTTAGGTCAGAAGG + Intronic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
1169504594 20:6195291-6195313 ATTTATGTCTTTAGCTCAGCTGG + Intergenic
1169845850 20:9990720-9990742 CTTTAGTTCTTTATGTAAAATGG - Intronic
1169894880 20:10492766-10492788 ATTTAGTTCTTTAATTCATCTGG + Intronic
1170016290 20:11785958-11785980 ATTCAGCTCTTTAGGTCAAAAGG - Intergenic
1170457443 20:16546779-16546801 ATTTATTTATTTACTTCAGATGG + Intronic
1173783280 20:45774113-45774135 ATTTACATATTTAGGACAGATGG - Intronic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1174831347 20:53815249-53815271 ATTTGGTTCTTTACATCAAAAGG - Intergenic
1175177849 20:57124144-57124166 TTATAGTTCTGGAGGTCAGAAGG - Intergenic
1177908606 21:27001789-27001811 ATTTATTTCTCTGAGTCAGAAGG + Intergenic
1178814583 21:35916717-35916739 ATTTAGTTCTTTAATTCATCTGG + Intronic
1178949389 21:36973985-36974007 ATTTATTTATTTATTTCAGACGG - Intronic
1182746880 22:32612830-32612852 ATTTATTTATTTAGGACACAGGG - Intronic
1183200510 22:36382796-36382818 ATTTATTTCTTTATTTGAGATGG - Intronic
1183545816 22:38454548-38454570 ATTTCGTTCTTCAGATCACAGGG + Intronic
1184135759 22:42548878-42548900 ATTTATTTTTTTTGGTGAGACGG - Intergenic
1184295594 22:43522281-43522303 ATTTATTTATTTATGTGAGACGG - Intergenic
951464494 3:22987582-22987604 ATCTTGTTCTTTAAGACAGAGGG + Intergenic
951954902 3:28242970-28242992 ATTTGGTTCTTGAGGGTAGAAGG + Intronic
952438571 3:33299043-33299065 ATTTATTTATTTTGGTGAGATGG + Intronic
953201038 3:40778956-40778978 CTTTGGTTCTTTAGACCAGAGGG + Intergenic
953242055 3:41158354-41158376 ATTTATTTATTTATCTCAGATGG - Intergenic
955730395 3:61979511-61979533 TTTTAGATAGTTAGGTCAGAAGG + Intronic
956535520 3:70271766-70271788 ATTTATTTATTTATTTCAGATGG + Intergenic
956836392 3:73099687-73099709 ATTTAGTTCTTTAATTCAATTGG + Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
961700301 3:128738744-128738766 ATTTAGTTCTTTCTTTCAAATGG - Intronic
961978547 3:131052766-131052788 CTGTAGGGCTTTAGGTCAGAGGG - Intronic
963372515 3:144419334-144419356 TTATAGTTCTAGAGGTCAGAAGG + Intergenic
963909842 3:150807465-150807487 ATTTAGTTATTTATTTTAGATGG + Intergenic
964240432 3:154586470-154586492 AGTTAATTCTCTAGGTCATATGG + Intergenic
964309853 3:155381074-155381096 ATTTATTTCTAAAAGTCAGAAGG + Intronic
964346532 3:155759611-155759633 ATTTAGTTCTTTATTTCTAAAGG - Intergenic
964610799 3:158613003-158613025 ATTTTGTTTTTTAGGAGAGATGG + Intergenic
966451297 3:180065701-180065723 CTATAGTTTTTTATGTCAGAAGG - Intergenic
966529920 3:180965489-180965511 TTATAGTTCTGTTGGTCAGAAGG + Intronic
968576589 4:1369086-1369108 ATTGACTTCTTGAGGTGAGAGGG + Intronic
970587550 4:17529031-17529053 TTTTTTTTCTTCAGGTCAGATGG - Intergenic
970651139 4:18179312-18179334 ATTGATTACATTAGGTCAGAGGG + Intergenic
971701203 4:29979242-29979264 ATTTAGTGCTCTAAGTCAGAGGG - Intergenic
972549801 4:40120772-40120794 ATCTGATTCTTTAGCTCAGAGGG + Exonic
972875947 4:43360214-43360236 ATATATTTCTTGAGTTCAGAAGG + Intergenic
974322106 4:60364560-60364582 AAAAAGCTCTTTAGGTCAGAGGG - Intergenic
974747925 4:66100229-66100251 ATTTATTTATTTATTTCAGATGG - Intergenic
974938593 4:68437162-68437184 ATTTATTTCTTCAGGTAGGAAGG - Intergenic
975270528 4:72427076-72427098 TTTCAGTTCTGTAGATCAGAAGG + Intronic
976673780 4:87682421-87682443 ATTAAGTTCTTTAGGTTCCATGG - Intergenic
978595834 4:110376041-110376063 ATTTTGTTCTTTAGTAGAGATGG + Intronic
978946791 4:114508895-114508917 ATTTAGTTCTTTGGACCACATGG + Intergenic
981752739 4:148108423-148108445 ATGTCATTCTTTAGGTCAAAAGG - Intronic
982080392 4:151783949-151783971 ATTTGGCTCTTTATGTCAAAAGG + Intergenic
982431311 4:155324832-155324854 TTGCAGTTCTGTAGGTCAGAAGG - Intergenic
982655271 4:158141028-158141050 ATTTCCTTCTTTAATTCAGACGG + Intronic
983645998 4:169992027-169992049 AATGAGTTCTTTAGGACCGAAGG - Exonic
984310470 4:178052134-178052156 ATTTAGTTCATTTGGTGACATGG + Intergenic
984769969 4:183428978-183429000 ATTTCTTTCTTTAGGTCAATAGG + Intergenic
984795425 4:183655958-183655980 ATTCAGTTCTTTATTTCAGATGG - Exonic
986157566 5:5191577-5191599 ATTTAGTTCTTATGTTCATATGG - Intronic
986921603 5:12690373-12690395 ATTTGGCTCTTTAGGTCAAAAGG + Intergenic
987683832 5:21171179-21171201 ATATAGTTATTTAGGTCAAAGGG + Intergenic
987686861 5:21215955-21215977 AGTTAGTTCTTTAAGGCAGAGGG + Intergenic
989766893 5:45097732-45097754 TTTTAGTTCTTTATTTCACATGG - Intergenic
989996561 5:50839966-50839988 ATTTTGTTCTGTAAGTGAGATGG + Intronic
990778660 5:59333176-59333198 ATCCAGTTCTCTAGGTCAAAAGG + Intronic
991050759 5:62270814-62270836 ATGTGGTTATTTAAGTCAGAAGG - Intergenic
991906038 5:71511701-71511723 TTTTTTTTCTTTAAGTCAGATGG + Intronic
994165887 5:96607695-96607717 AGTTTGTTCTTTAAGTCAGTTGG + Intronic
995367421 5:111378485-111378507 ATTTGGATCTTTAGGTGAGAAGG + Intronic
995401165 5:111743346-111743368 ATATATTTCTTGAGGTCACAGGG - Intronic
995496249 5:112747525-112747547 ATTTAGATCTTTAATTCATAAGG - Intronic
995862476 5:116656148-116656170 ATTTTTTACTTTATGTCAGATGG - Intergenic
995986397 5:118180126-118180148 ATTAAGTACTTTTGGTTAGACGG - Intergenic
996532020 5:124536171-124536193 ATTTATTTATTTATGTGAGATGG - Intergenic
996921316 5:128770778-128770800 ATTTAGTTCTTTCTTGCAGATGG - Intronic
999042436 5:148429283-148429305 GTTTAGTTCCTTAGTTCAGTTGG + Intronic
1000023083 5:157335911-157335933 ATTTAGTGCTTTTGGACAGGTGG - Intronic
1000863213 5:166481619-166481641 ATTTTGTTTTCTAGGACAGAAGG + Intergenic
1001257438 5:170194833-170194855 ATTTAGTGTTTTAGTTCAGAGGG - Intergenic
1001505528 5:172276640-172276662 ATTATGTTCCTTAGGACAGATGG + Intronic
1002178011 5:177413281-177413303 ATTTAGTTATTTATTTGAGATGG + Intronic
1002838561 6:886343-886365 ATTTATTTATTTATTTCAGATGG + Intergenic
1003038817 6:2668763-2668785 ATTTATTTTTTTAAGTAAGAAGG + Intronic
1003267262 6:4576623-4576645 ATTTAATTCTTCAAGTCATAAGG + Intergenic
1004269066 6:14177709-14177731 ATTTAGTGCATTAGGCCAGGTGG - Intergenic
1005457954 6:26039598-26039620 ATTTAGGTCTTTACATCACAAGG - Intergenic
1005696752 6:28358937-28358959 TTCCAGTTCTATAGGTCAGAAGG + Intronic
1005896985 6:30186602-30186624 GTTTTGTTTTTTAAGTCAGAGGG + Intronic
1008503486 6:52206702-52206724 ATTTATTTATTTATTTCAGATGG - Intergenic
1009298158 6:61980898-61980920 ATTCAGCTCTTTATGTCAAAAGG - Intronic
1009321689 6:62298282-62298304 TTATAGTTCTTGAGGTCAGAAGG - Intergenic
1009948659 6:70369068-70369090 ATTTATTTATTTATTTCAGATGG - Intergenic
1010014826 6:71092318-71092340 ATTTAGTTCTGTAGGTCCCCTGG + Intergenic
1010336742 6:74693729-74693751 CTTTAGTGCTTTAGATGAGATGG - Intergenic
1011466066 6:87658571-87658593 ATCTACTTCATTAGGTCAGGTGG + Intronic
1011579665 6:88846345-88846367 ACTTAGTTCTTTATGTAATAAGG - Intronic
1015315766 6:131814391-131814413 TTTTTTTTCTTTAGGTCAGCAGG - Intronic
1015458038 6:133451612-133451634 ATTGTGTTCTTTAGGTCACTGGG - Intronic
1015657547 6:135536384-135536406 GTTTAGTTATTGAGGTCAGAAGG - Intergenic
1015939579 6:138434166-138434188 CATTAATTCTTTATGTCAGAAGG + Intronic
1019870098 7:3752404-3752426 ATTAAAATCTTGAGGTCAGATGG - Intronic
1020403405 7:7803627-7803649 ATTTATTTCTTTAGTTCTGGAGG + Intronic
1020598335 7:10240701-10240723 ATTTAATTCTTAAAGTCAGTGGG - Intergenic
1021468308 7:20970908-20970930 ATTCAGTTCTTTATCTTAGAAGG - Intergenic
1021787697 7:24168867-24168889 TTATAGTTCTGTAGGTTAGAGGG + Intergenic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1024376994 7:48651600-48651622 ATTTATTTATTTATTTCAGATGG + Intergenic
1025479951 7:60970250-60970272 AATTAGTTCTGTATGTTAGACGG + Intergenic
1025552009 7:62262103-62262125 AATTAGTTCTTTATGTTAGACGG - Intergenic
1025557814 7:62331206-62331228 AATTACTTCTTTATGTTAGAGGG - Intergenic
1027630630 7:80600596-80600618 AGTTGGCCCTTTAGGTCAGATGG - Intronic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029601700 7:101567590-101567612 ATTTAATTCTTTAGGTCCTCTGG - Intergenic
1031302256 7:120076326-120076348 AATTAGTTCATTAGGTCCTATGG + Intergenic
1031640411 7:124156702-124156724 ATTTAAGTGTTTAGGCCAGAAGG - Intergenic
1031773549 7:125877415-125877437 ATTTACTTCTTCAGGTCTGCAGG - Intergenic
1032549851 7:132774470-132774492 AGTTTGTGCTTCAGGTCAGAGGG - Intergenic
1034083843 7:148305488-148305510 ATGTAGTTCTTTATAGCAGAAGG - Intronic
1035409492 7:158627691-158627713 ATTTATTTCTTTATGCCATATGG - Intergenic
1035835551 8:2748148-2748170 ATTTATTTATTTATGTGAGATGG + Intergenic
1035994165 8:4527200-4527222 ATTTAGTTGTTTTGGCCAGTTGG + Intronic
1036937256 8:13015052-13015074 ATTTATTTATTTATTTCAGATGG - Intronic
1038118688 8:24587136-24587158 TTTTATTTTTTTAGTTCAGATGG - Intergenic
1040859868 8:51988223-51988245 ATTTGGTTCTTTACATCAAAAGG - Intergenic
1041320257 8:56605070-56605092 ATTTAGCTCATTAAGTCAGCAGG - Intergenic
1041451517 8:58011456-58011478 ATTTGGCTCTTTATGTCAAAAGG - Intronic
1042539546 8:69894360-69894382 ATTTATTTATTTTGATCAGAAGG + Intergenic
1043300096 8:78717314-78717336 CTTTACTTTTTTAGGCCAGATGG + Exonic
1043345329 8:79291502-79291524 TTACAGTTCTGTAGGTCAGAAGG - Intergenic
1043788701 8:84435261-84435283 ATTTATTTCTGTATGTGAGAAGG + Intronic
1046769601 8:118105237-118105259 TGTTAGTTCTTTCTGTCAGAAGG - Intronic
1048851332 8:138647961-138647983 ATTTAGTTCATTAAGATAGATGG - Intronic
1049032708 8:140049301-140049323 ATTTATATTTTTAAGTCAGATGG - Intronic
1050915440 9:11124765-11124787 TTATAGTTCTCTAGGTCAGAAGG + Intergenic
1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG + Intronic
1057444423 9:95103832-95103854 AGTGCGTCCTTTAGGTCAGATGG + Intronic
1059122307 9:111652337-111652359 ATTTTTTTTTTTAGGACAGATGG - Intronic
1187154169 X:16708515-16708537 ATTTATTTATTTATTTCAGACGG - Intronic
1187799525 X:23045172-23045194 GTTTAGTTCTTGGGGTCAGGCGG - Intergenic
1187917841 X:24172098-24172120 ATTTACTTCTCTAGATGAGAGGG + Intronic
1187987737 X:24832910-24832932 ATTTATTTATTTATTTCAGATGG + Intronic
1189774763 X:44460713-44460735 ATTTTCTTCTTTCAGTCAGATGG - Intergenic
1197260268 X:124309882-124309904 ATTTATTTATTTTGGTCACAAGG - Intronic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1197731655 X:129815401-129815423 ATTTAGTTCTTTAATTCATCTGG - Intronic
1197912765 X:131502682-131502704 TTTTATTTTTTTTGGTCAGATGG + Intergenic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1199116853 X:144002551-144002573 AGTTGGTTCTTTATGTCAAAAGG + Intergenic
1201689875 Y:16751969-16751991 ATATACTCCTTTAGCTCAGAGGG + Intergenic