ID: 957118391

View in Genome Browser
Species Human (GRCh38)
Location 3:76057146-76057168
Sequence TATAAATAAAAGGTCTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957118391_957118393 -1 Left 957118391 3:76057146-76057168 CCTTCTAAGACCTTTTATTTATA 0: 1
1: 0
2: 4
3: 39
4: 390
Right 957118393 3:76057168-76057190 ACGTGCTTCAATCTGATACTAGG 0: 1
1: 0
2: 1
3: 3
4: 54
957118391_957118394 8 Left 957118391 3:76057146-76057168 CCTTCTAAGACCTTTTATTTATA 0: 1
1: 0
2: 4
3: 39
4: 390
Right 957118394 3:76057177-76057199 AATCTGATACTAGGCGTATGCGG 0: 1
1: 0
2: 0
3: 5
4: 31
957118391_957118395 9 Left 957118391 3:76057146-76057168 CCTTCTAAGACCTTTTATTTATA 0: 1
1: 0
2: 4
3: 39
4: 390
Right 957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957118391 Original CRISPR TATAAATAAAAGGTCTTAGA AGG (reversed) Intronic
902666408 1:17942148-17942170 TTTAAATAAGAGGTCTAAGAAGG - Intergenic
904679329 1:32217978-32218000 TAAAAATAAAAAGTGTCAGAAGG + Intronic
907228696 1:52974600-52974622 TATAAATAAAAATTTTTTGAGGG + Intronic
907660464 1:56387776-56387798 AATAAATAAATTGTCTTAGAAGG - Intergenic
909122074 1:71616048-71616070 TATAAATAAAAGGATTTTGTGGG + Intronic
909201042 1:72690415-72690437 TCTAAATAAAAAGTCATAAAAGG + Intergenic
910035796 1:82786475-82786497 TATAAATGAGAAGTTTTAGAAGG + Intergenic
910055497 1:83028957-83028979 TATTAATAAAATCTCTTATAAGG + Intergenic
910071934 1:83226680-83226702 TATAAATAAAAGGCCTCTAACGG + Intergenic
910164861 1:84315585-84315607 TAAAAATAAAATGTACTAGATGG - Intronic
910390378 1:86737263-86737285 TATCAATAAAAGTTCTTAGAAGG + Intronic
910675405 1:89811441-89811463 TATAAATAAATGCTTTTTGAAGG + Intronic
910685159 1:89908602-89908624 CATACATAACTGGTCTTAGAAGG - Intronic
911426084 1:97714519-97714541 TTTAAATACAAGGCCTTAGAAGG - Intronic
911484890 1:98493166-98493188 TACAAATATAAGGACTTAGAGGG + Intergenic
912348233 1:108986037-108986059 TATAATTAAAAAGTCTTAAGAGG + Intronic
912889951 1:113519570-113519592 TATAAATCAAAGCTATTAGTAGG - Intronic
913374350 1:118134005-118134027 TAAAAATAAAAGGTTGAAGAGGG + Intronic
913381925 1:118220885-118220907 TATAAATATAAGCTCCTTGAAGG + Intergenic
913519020 1:119628291-119628313 TGTCCATAAAAGGGCTTAGAGGG - Intronic
914239135 1:145839917-145839939 TATAAATAGAAGGTCCTGGATGG - Exonic
915513431 1:156399691-156399713 TATAATTAAAAGGTGTTTGAGGG - Intergenic
918334121 1:183490771-183490793 TATAAATAAAAGCACTTTGGGGG - Intronic
919132205 1:193465436-193465458 TTTCAATAAAAGGTTTTAAAAGG - Intergenic
919350897 1:196452715-196452737 TATAAATAGATGGTATTATAAGG + Intronic
919693985 1:200553999-200554021 TATAAATACAAGTTCCTATATGG + Intronic
920126604 1:203698613-203698635 AATAAATAAAATGTCTTAAAAGG - Intronic
920417342 1:205807538-205807560 CAAGAATAAAAGTTCTTAGATGG - Intronic
921418441 1:214918097-214918119 AATAAATCAAAGTTATTAGAAGG + Intergenic
921458413 1:215399769-215399791 TATTAATAAATGTTCTTAGTTGG + Intergenic
922149135 1:222981946-222981968 CATAAACAAAAGCTCTTTGAAGG - Intronic
923804192 1:237240373-237240395 TATTAATAAAAGGTGTTTGGGGG - Intronic
1063038385 10:2312056-2312078 AATAAATAAAGGAACTTAGATGG + Intergenic
1063277437 10:4586026-4586048 TATAAATAATAAATGTTAGAGGG + Intergenic
1063421945 10:5919564-5919586 TGTAAATAAAAGCTCTTTGGAGG + Intronic
1063718910 10:8558556-8558578 TATAAATAAAATTTTTAAGAGGG - Intergenic
1064311079 10:14212298-14212320 TAGAAACAAAAGGTCTAAGCAGG - Intronic
1064980386 10:21160771-21160793 GATGAATAAAAGGTCTTAACAGG - Intronic
1065674327 10:28157897-28157919 TATAAATACAAAGTCTGATAAGG - Intronic
1066328150 10:34387278-34387300 TATATATAAACGGTCTTCAATGG + Intronic
1068039482 10:51805788-51805810 TGAATATAAAAGGTCTTACATGG - Intronic
1068326461 10:55494575-55494597 TATAAATAAAAGTTATTAAATGG - Intronic
1068807011 10:61208024-61208046 TAAAAATAAAAAATCATAGAAGG + Intergenic
1068958091 10:62839000-62839022 TAAAAATAATAGGATTTAGAAGG - Intronic
1069033536 10:63624407-63624429 TAGATTTAAAAGGTGTTAGAAGG - Exonic
1073634351 10:105182073-105182095 TAGAAAAAAAAAATCTTAGAAGG + Intronic
1073677724 10:105667747-105667769 TAAAAATAAAAGGTTTAAGACGG + Intergenic
1074595136 10:114856922-114856944 TAAAGATAAAAGGTTTCAGACGG - Intronic
1074799475 10:116984895-116984917 TAAGTATGAAAGGTCTTAGAGGG - Intronic
1077001130 11:322937-322959 TAACAATAAAAGGCCTCAGAGGG - Intronic
1077885126 11:6381800-6381822 AATAAATAAAAGATCTTAATGGG + Intergenic
1078001550 11:7500700-7500722 TAAAAATAAAATGTTTAAGAAGG + Intronic
1078533078 11:12151989-12152011 TAAGAATCAAAGGTCTTAGCTGG + Intronic
1079263655 11:18909186-18909208 AATAATTAAAAGTTCTTAAAGGG - Intergenic
1079411797 11:20194506-20194528 TTTAAATAAAAGGTTTTTGTGGG + Intergenic
1079532773 11:21475187-21475209 AATAAATAAAAGTTCTTTCATGG - Intronic
1079610264 11:22424356-22424378 TTTAATAAAAAGGTCTTAGCAGG - Intergenic
1079731974 11:23944433-23944455 TATAAATAAAAGCTGTAAGAAGG + Intergenic
1079740193 11:24049014-24049036 TATAAATGCAAGGACTTAGCAGG + Intergenic
1080772412 11:35354153-35354175 TATAAAAAGAAAGTCTTAGCTGG + Intronic
1080888431 11:36387767-36387789 TCCACATAAAAGGTCTGAGAAGG + Intronic
1081275402 11:41142130-41142152 TATATATAACAGGTATTAGCAGG + Intronic
1081524537 11:43916943-43916965 TCTAAGTCAAAGATCTTAGAAGG + Intronic
1083009057 11:59377103-59377125 TATGGGTAAAAGGTATTAGAGGG + Intergenic
1083063095 11:59894990-59895012 TATAAATCAAAGGGCTTGAATGG + Intergenic
1086608003 11:88720221-88720243 TATTCAAAAAAGGGCTTAGATGG - Intronic
1087018044 11:93573694-93573716 TATAAATAAAAGGCCTTGGATGG - Intergenic
1088360534 11:108984503-108984525 TAAGAATAAAAGATCTTAGTGGG - Intergenic
1088840229 11:113620908-113620930 GAAAAAAAAAAGGACTTAGAAGG + Intergenic
1089266841 11:117269953-117269975 TATAAATGAAAAGTCTTACCTGG + Intronic
1090097145 11:123753654-123753676 TATAAATAAAGGGATTCAGAAGG + Exonic
1090637426 11:128699092-128699114 TTTAAATAAAATCTATTAGAAGG + Intronic
1091841142 12:3621701-3621723 TAAAAATAAAGGAGCTTAGAAGG + Intronic
1092887249 12:12935837-12935859 TATAAGTAAATGATTTTAGATGG + Intergenic
1093154049 12:15658980-15659002 GATACTTAAAAGGTATTAGATGG + Intronic
1093566962 12:20618335-20618357 AATAAATAAAAGGGCTAAAAGGG - Intronic
1093623278 12:21317492-21317514 GATATATACAAGGTCTTACAGGG - Intronic
1094077908 12:26498084-26498106 AATAAATAAAAGTTGTTACAAGG - Intronic
1094691659 12:32775210-32775232 AAAAAATAAAAGTTTTTAGATGG + Intergenic
1095258294 12:40067535-40067557 TATAAATAAAATGGTTTAAAAGG - Intronic
1095741348 12:45610191-45610213 AATAAATAAAATTTCTTAGCTGG - Intergenic
1095850868 12:46803659-46803681 TATAAATCAAAGCTGTTACACGG - Intronic
1097539250 12:60916069-60916091 TATAAATAAAAGTTTTTATATGG + Intergenic
1098093851 12:66933353-66933375 TAAAAATAAATTGTCTTATATGG + Intergenic
1098203916 12:68085860-68085882 TACAAATAAAAGTTATTAAAGGG - Intergenic
1099022130 12:77419533-77419555 TTTAAAATAAAGGTCTGAGAGGG + Intergenic
1099099087 12:78414356-78414378 TGTAAATAACTGGTTTTAGAAGG + Intergenic
1099341084 12:81435495-81435517 TATAAAGAAAAGATATTAGGAGG + Intronic
1100109080 12:91215775-91215797 TCTAAGGAAAATGTCTTAGAAGG - Intergenic
1100725778 12:97406938-97406960 TACATAGAAAAGATCTTAGAAGG - Intergenic
1100964361 12:99996470-99996492 TATAAAGAAAATGTATTAGGAGG + Intergenic
1101195641 12:102379101-102379123 TATAAAGACAAGGACTTCGAGGG + Intergenic
1101314560 12:103617288-103617310 TAAATATCAAAGATCTTAGATGG + Intronic
1103266254 12:119633039-119633061 TAGGAATAAAAGGTATGAGAAGG + Intronic
1104664278 12:130636242-130636264 CACAGATGAAAGGTCTTAGAGGG - Intronic
1105375805 13:19843422-19843444 TATAAATAAAAGCTCTTTCATGG - Intronic
1107206935 13:37802958-37802980 AATAAATAAATGGACATAGAAGG - Intronic
1108458400 13:50640335-50640357 TAGAAATAGGAGGTCATAGAAGG - Intronic
1108528419 13:51305286-51305308 AATAATTAAAAGGTCTTCTATGG + Intergenic
1109102343 13:58201021-58201043 TATAAATACATGGTCTAATATGG - Intergenic
1109614348 13:64810434-64810456 TTTAAATAAAATGGCTTAGGAGG - Intergenic
1110120765 13:71878299-71878321 TAAATATAATAGGTATTAGATGG + Intergenic
1110666908 13:78127495-78127517 AATCAATAAAAGATCTTTGATGG - Intergenic
1110919921 13:81070236-81070258 CATATATAAAAGTTCTTATAGGG - Intergenic
1111033590 13:82639924-82639946 TATAAAGAAAAAGTTTTTGAAGG - Intergenic
1111223247 13:85234105-85234127 TGTAGATAAAACGTCTTATAAGG + Intergenic
1111381460 13:87458591-87458613 CACAATTAAAAGGCCTTAGAAGG + Intergenic
1111560420 13:89937637-89937659 TATAAATGATAATTCTTAGAAGG + Intergenic
1112685971 13:101827475-101827497 TATAAAAAATAAATCTTAGATGG - Intronic
1114337796 14:21710818-21710840 TATAAATAAAAGGTTTCTGTTGG + Intergenic
1116146997 14:41087044-41087066 TATATAATTAAGGTCTTAGAAGG - Intergenic
1116318645 14:43431264-43431286 TCTAAATAAAAGGTGCTACATGG + Intergenic
1116419035 14:44712000-44712022 TCTAAATAAAAAGTGTTGGAAGG + Intergenic
1116670715 14:47839065-47839087 TATAAATAAAAAGACATTGATGG - Intergenic
1117304689 14:54461750-54461772 TATAAGTATAATGTCTTAGCTGG - Intergenic
1117362781 14:54993882-54993904 TATAAATAAATGCTCTCGGAAGG + Intronic
1120154047 14:81071776-81071798 AATAAATAAATAGTCTCAGATGG + Intronic
1121578191 14:95006098-95006120 TCTATATAAAGGGTCTCAGAAGG + Intergenic
1122184315 14:99978425-99978447 TAGAAATAAAAGTTCTTAAGTGG + Intronic
1122185255 14:99987664-99987686 AATAAATAAAAGGGGTTTGAGGG + Intronic
1124463856 15:29918751-29918773 TATAAATAAAAAAGGTTAGATGG + Intronic
1124485941 15:30116361-30116383 TAGGAAAAAAATGTCTTAGAGGG - Intergenic
1124517634 15:30380908-30380930 TAGGAAAAAAATGTCTTAGAGGG + Intronic
1124757641 15:32422237-32422259 TAGGAAAAAAATGTCTTAGAGGG + Intergenic
1125526437 15:40378649-40378671 TAAAAAAAAAAAGTCTGAGATGG + Intergenic
1125804726 15:42483652-42483674 AATATTTAAAAGGTCTTACAAGG + Intronic
1126102364 15:45127116-45127138 TTTAAATAAAAGTTCATAGGAGG + Intronic
1126524930 15:49642763-49642785 TAAAAATAAAAAATCTTAGCTGG + Intronic
1126793371 15:52240743-52240765 AATAAATAAAATGTTTTAAAAGG + Intronic
1126853563 15:52815374-52815396 TTTAAATAAAAGGACAGAGATGG + Intergenic
1129043425 15:72710698-72710720 TATAAATTAAAAACCTTAGATGG - Intronic
1129583861 15:76841961-76841983 AATAAATAAAAGGGCTTCCAGGG + Intronic
1129775758 15:78235279-78235301 AATGAATACATGGTCTTAGAGGG - Intronic
1130632689 15:85584624-85584646 TATAATTATAAGGTCAAAGAAGG + Intronic
1131679535 15:94706878-94706900 TATAAAAAAATTTTCTTAGATGG + Intergenic
1131768831 15:95712313-95712335 TGTAAATAAACTTTCTTAGAAGG + Intergenic
1132384187 15:101388539-101388561 TATAAATGAAAGTTCCTAAAAGG + Intronic
1134479693 16:14607534-14607556 TATAAAGAGGAGGTTTTAGATGG + Intronic
1134485374 16:14653995-14654017 AAAAAAAAAAAGTTCTTAGATGG - Intronic
1137275590 16:46931264-46931286 TATAAATAAAATGTCCAAAATGG + Exonic
1137466206 16:48712157-48712179 AACAAGTAAAAGTTCTTAGAGGG + Intergenic
1139017759 16:62711032-62711054 TATAAATAAAAGGTGTTACATGG + Intergenic
1143436901 17:6935678-6935700 TATAACAAACAGGTCTTTGAAGG + Intronic
1143920228 17:10325657-10325679 TATAAATAAATATTCTTATATGG - Intronic
1144210171 17:13007898-13007920 AATAAATAAAAGGTAATTGAAGG + Intronic
1145106184 17:20119526-20119548 TAAAAATAAAAGCTCTTGGCTGG - Intronic
1146046898 17:29516255-29516277 TTTAAATAAAAGTTCTTGGCTGG - Intronic
1146067680 17:29649333-29649355 TATAAGGAAAAGGTACTAGAAGG - Intronic
1146557671 17:33840583-33840605 TGTTAATCAAAGGTTTTAGAAGG + Intronic
1146954959 17:36932122-36932144 AATAAATAAAACGTCTAAGACGG - Intergenic
1147220521 17:38926382-38926404 CAGAAATAAAAAGTCTCAGATGG - Intergenic
1148248112 17:46049229-46049251 AAAAAAAAAAAGGTCTTGGATGG - Intronic
1149621131 17:58046041-58046063 TATAAATAGAATGTGATAGAAGG + Intergenic
1149952161 17:61000102-61000124 AATAAATAAAAGGCATTAAATGG - Intronic
1150676998 17:67252818-67252840 TATACTTAAAAACTCTTAGATGG + Intergenic
1151822462 17:76504094-76504116 TAAAAATAAAAAAGCTTAGACGG - Intergenic
1153919401 18:9774830-9774852 TAGAATTAATAGGTCTTAAAGGG + Intronic
1155662447 18:28265819-28265841 TATAAAGAAAGGGTATCAGAGGG - Intergenic
1156161441 18:34363136-34363158 AATAAATAAAATTTCTTATATGG + Intergenic
1156324299 18:36059962-36059984 TTTAAATATAAGAACTTAGAAGG + Intronic
1156537852 18:37880932-37880954 TTTAAGTAAAAAGGCTTAGAAGG + Intergenic
1156647187 18:39179319-39179341 TATAAGTCAAATGACTTAGATGG + Intergenic
1159134335 18:64319252-64319274 TATAAATTAAAGGTGATGGATGG - Intergenic
1159214610 18:65374820-65374842 TAAAAATGAACAGTCTTAGAGGG - Intergenic
1159524969 18:69576928-69576950 TATAAATAAAATCCCTTAGAAGG + Intronic
1159778520 18:72632712-72632734 TATAAATAATAGTGCCTAGAGGG - Intronic
1160039232 18:75330784-75330806 TTTAAAGAAAAAGTCTCAGATGG - Intergenic
1160086925 18:75784820-75784842 AAAAAATAAAAACTCTTAGAAGG + Intergenic
1166590521 19:43993708-43993730 TATAAATAAGAGGTCTTGGCTGG - Intronic
1167673139 19:50867381-50867403 CATAAATAAAAGCTCTTGGAGGG + Intronic
925212432 2:2061380-2061402 TACAAATAGAACGGCTTAGAGGG - Intronic
925996313 2:9296348-9296370 TTTAAATCAGAGGTCTGAGATGG + Intronic
929376533 2:41293232-41293254 TATAAATAAAGGGTCAGAGTAGG - Intergenic
929733894 2:44524901-44524923 TAAAAACAAAAGATCTTAGGAGG - Intronic
930362084 2:50393967-50393989 TATAAATAAAACATCTGACACGG + Intronic
930600704 2:53439741-53439763 TATAAATAAAAGATCTTGAAAGG + Intergenic
930796381 2:55396322-55396344 TAGAAATAAAAGGTAGAAGAAGG - Intronic
931892924 2:66694869-66694891 TATAAATAAAAGGTAATGTATGG + Intergenic
932088845 2:68786924-68786946 TAAAATAAAAAGGTCTTAGCGGG - Intronic
932099707 2:68887285-68887307 TAGAAATAAAAGGAGCTAGAAGG + Intergenic
932508321 2:72258713-72258735 TAATAATAAAAGGTTTTAGAAGG + Intronic
933681305 2:85103897-85103919 TATATGTAAAAGGACTAAGATGG + Intergenic
935904144 2:107825720-107825742 TATAAATAAAAGGTAATGAAGGG + Intergenic
936103641 2:109605028-109605050 TTTACATAAAAGTTCTTTGAGGG - Intronic
936775635 2:115969130-115969152 TATGAATTTAAGGTCTTTGATGG + Intergenic
936990872 2:118364688-118364710 TACTAAGCAAAGGTCTTAGAAGG + Intergenic
938217405 2:129531893-129531915 TATAAATAAAAGAAATTAGAGGG + Intergenic
939124065 2:138154274-138154296 TATAAATGACAGGTCTTTCATGG + Intergenic
939161717 2:138597915-138597937 TATAAATAAGTAGTATTAGAAGG + Intergenic
939390779 2:141567112-141567134 TATAAATAAAACTTTTTAAAAGG + Intronic
939433450 2:142141718-142141740 AATAAATAAAAGGTTTTAGCCGG - Intergenic
939730763 2:145782106-145782128 TAAAAATAAAAAGACTTAGAAGG - Intergenic
939974220 2:148697633-148697655 TATAAATCAAAGACATTAGAGGG + Intronic
940068847 2:149661803-149661825 TATGAATATAATGTCTGAGATGG - Intergenic
940588097 2:155682746-155682768 TATAAATAAATGTTCTTGCAAGG - Intergenic
941195077 2:162440448-162440470 TATAAATACCAGAACTTAGAGGG - Intronic
941854598 2:170218071-170218093 TTTTAATAAAAGGACTCAGATGG + Intronic
942782144 2:179656695-179656717 TATGAAAAAAATGTCTAAGAAGG - Intronic
943347164 2:186752867-186752889 TATAAATAAAACTTCATAAAAGG + Intronic
943946099 2:194067237-194067259 TAAAAATAAAAAGACTTAAAAGG + Intergenic
945682970 2:212935910-212935932 TATAAATAATACAACTTAGAGGG - Intergenic
946266923 2:218552668-218552690 TTTAAATGAAAGGGGTTAGAGGG + Intronic
946914330 2:224501100-224501122 TTTAAATAAAAGGTCAAGGAGGG + Intronic
947557709 2:231111153-231111175 TATAAAATTAAGGTCTTAGAAGG - Intronic
1169173944 20:3491893-3491915 TGCAAATAAAAGGTATCAGATGG + Intronic
1170328826 20:15185625-15185647 TATAAATATAACGACTTAGATGG + Intronic
1173396499 20:42685127-42685149 TATACACAAAAGGTCTTAAGGGG + Intronic
1173751895 20:45482869-45482891 TTTAAGTAAAAAGTCATAGAAGG + Intergenic
1174603580 20:51744131-51744153 AATAAATAAATGGTCTAAGCAGG - Intronic
1174666669 20:52264519-52264541 CATGAATAAAATGTCTAAGAAGG - Intergenic
1176895231 21:14369671-14369693 GGTAAATAAGAGGTCTTACATGG + Intergenic
1176949144 21:15023522-15023544 TATAAATAAAATATATTGGAAGG + Intronic
1177122938 21:17161043-17161065 AATAAAGAAGATGTCTTAGAAGG - Intergenic
1178078535 21:29036516-29036538 TTTAACTATAAGGTATTAGAAGG + Intronic
1179331355 21:40405281-40405303 TATATACACAAGGTCTCAGAGGG - Intronic
1182036224 22:27200580-27200602 CATCAATAAAAGGTCTTACTAGG + Intergenic
1182202904 22:28591932-28591954 TATGAATAAAAGATGGTAGAGGG + Intronic
1182760243 22:32716816-32716838 TTTAAAAAAAAGGTCAGAGAGGG - Intronic
1184915884 22:47568735-47568757 TATAAAGAAAAGGGTTTTGATGG + Intergenic
1185090752 22:48771121-48771143 AATAAATAAAAGGTATAAAAAGG - Intronic
950315026 3:11994460-11994482 TATAAAAAAAAGATCACAGATGG + Intergenic
950896515 3:16456615-16456637 CATAAACAAAAGTTCTTAGGGGG - Intronic
951984228 3:28600468-28600490 TCTAAATAAAAGATCACAGAAGG + Intergenic
952175328 3:30856483-30856505 AATAAATAAAAGCCCTTAGATGG - Intronic
952253592 3:31677078-31677100 TATAAAAATGAGGTCTTACATGG - Intronic
952667085 3:35920426-35920448 TAGTAATAAAAGGTCAAAGAAGG - Intergenic
953512047 3:43552196-43552218 TATAAATAACAGATGGTAGAGGG - Intronic
953823313 3:46228514-46228536 TATCATTAAAAGATCATAGAAGG - Intronic
954162438 3:48732593-48732615 TAGAAATAAAAGCACTGAGATGG + Intronic
954570288 3:51635219-51635241 GATAAATACAAGGTCACAGAAGG - Intronic
954937705 3:54342262-54342284 TGTAAATAATAGGCATTAGAGGG + Intronic
955012706 3:55035025-55035047 TATAAAGAACAGGTATTAGGTGG + Intronic
955465711 3:59235257-59235279 TAAAAATATAATTTCTTAGAAGG - Intergenic
955551298 3:60087957-60087979 TATAAATAAAAGGATTTATGTGG + Intronic
955563524 3:60219797-60219819 TTTAGATACAAGATCTTAGAAGG - Intronic
956221037 3:66903465-66903487 TACAAATAAAGGGTATGAGAAGG - Intergenic
956938229 3:74128240-74128262 TATTAATAAAAGGTATTCCATGG - Intergenic
957118391 3:76057146-76057168 TATAAATAAAAGGTCTTAGAAGG - Intronic
957393781 3:79614827-79614849 TATAAATAAAGAGTCTTATTTGG + Intronic
957438067 3:80205254-80205276 TATAAATAAAAATTCCCAGAAGG + Intergenic
957617414 3:82548386-82548408 TAAATATAAAAGGTCATAGTTGG + Intergenic
958454283 3:94309939-94309961 TAAAACTAAAGGGTCTAAGAAGG - Intergenic
958715782 3:97778525-97778547 TATAAAAAAACAGTATTAGAGGG - Intronic
959412475 3:106042398-106042420 TATAAAATAAAGGTCTCACATGG - Intergenic
960283819 3:115805070-115805092 TTTAAATAAGACATCTTAGATGG + Exonic
960304965 3:116050100-116050122 TATTAATAAAAGATCTGAAAGGG + Intronic
961702266 3:128754817-128754839 TATTAATAAAAGGTTTAATACGG + Intronic
961909463 3:130300112-130300134 TACAAAAAAAAGGTGTTAGTAGG - Intergenic
962132565 3:132697903-132697925 TACAAATAAAATGTCTAAAATGG + Intronic
963871706 3:150422515-150422537 TATAAATAAATGGATTTTGAAGG + Intronic
964184433 3:153925341-153925363 AATAAATAACAGGGATTAGATGG + Intergenic
965932268 3:174059416-174059438 TATAAATGAAAGGTTTTGGGTGG + Intronic
966215035 3:177493246-177493268 TATAACTAGAAGTTCTCAGATGG - Intergenic
967012750 3:185452207-185452229 TAAAAATAAAAGTTTTGAGATGG - Intronic
967126501 3:186429253-186429275 TATAAATAAAAGCATATAGAAGG - Intergenic
967729057 3:192890308-192890330 CATAAATAAAAAGACTAAGAAGG + Intronic
967881221 3:194303057-194303079 CAAAAAAAAAAGGTCTTGGAGGG + Intergenic
971163638 4:24159776-24159798 TTTATATAAAACTTCTTAGAGGG + Intergenic
971669250 4:29534436-29534458 TAGAAATAAAAGGTCACAGCAGG + Intergenic
971999210 4:34008339-34008361 TACAAAAAAAAAGTCTTAGCTGG + Intergenic
975267689 4:72390449-72390471 TTAAAATAAATTGTCTTAGATGG + Intronic
975409483 4:74032740-74032762 TACAAATAGAAGATTTTAGAAGG + Intergenic
976403018 4:84629023-84629045 TATAAATAAAAGTACTGAAAAGG - Intronic
977101659 4:92823751-92823773 AATAAACAAAAGGGCTTAGAAGG - Intronic
977298844 4:95243956-95243978 CATAAATAAAAGCTCTCAAAGGG + Intronic
978343833 4:107744943-107744965 AAAAAATAAAATGTCTGAGATGG - Intergenic
978552322 4:109940458-109940480 GAAAACTAAAAGGTCTTAGACGG - Intronic
978673178 4:111276155-111276177 AATAATAAAAAGGTCTTATAGGG + Intergenic
978741475 4:112143053-112143075 TATATATAAGAGGACTCAGAAGG - Intergenic
978993208 4:115113629-115113651 TATAAATAAAAGGACTCTGCTGG - Exonic
979131270 4:117048641-117048663 TATAAATAAAATCTCTTTTATGG + Intergenic
979549916 4:121979117-121979139 TCTAAGTAAAAGACCTTAGATGG + Intergenic
980029730 4:127813608-127813630 TATAAACACCTGGTCTTAGAAGG - Intronic
980661974 4:135872649-135872671 TAAAAATAAAAGGTCTTAGGAGG - Intergenic
982465667 4:155727811-155727833 TATAAATAGAAACTCTTACATGG + Intronic
982568229 4:157014426-157014448 TATAATTAAAAGGTATTTTAAGG + Intergenic
982766534 4:159355596-159355618 TAAAGATAAAAGTACTTAGATGG + Intronic
982969265 4:161960998-161961020 TATAAATTAAATTTCTTAAATGG - Intronic
984051843 4:174873981-174874003 TATAAATAAAAAGTCTGAAAAGG - Intronic
984210156 4:176837625-176837647 TTTAAAAAAAAGGTCTTTGTAGG + Intergenic
984242525 4:177234784-177234806 TAAAAATAAAATGTCTTGGATGG - Intergenic
984864358 4:184268996-184269018 TAAATAAAAAAGGTCTGAGAAGG + Intergenic
986139366 5:5015525-5015547 TGGAAATAAAAGGTCAGAGAAGG - Intergenic
986409377 5:7461489-7461511 AATAAATAAAAGCTATGAGAAGG - Intronic
986681646 5:10238542-10238564 TATAAATAAAAGGCCACTGATGG - Intronic
988189837 5:27915338-27915360 TAGAAATAAAACGTATTAGTGGG - Intergenic
988765035 5:34363332-34363354 TATAAATAAAATGTTTAACATGG + Intergenic
989013494 5:36901489-36901511 AAAAAAAAAAAGGACTTAGAAGG - Intronic
989304927 5:39943300-39943322 TAAAAATAATAGGTGTTAGTAGG - Intergenic
989422710 5:41258590-41258612 TATATTGAACAGGTCTTAGAGGG + Intronic
990423064 5:55656832-55656854 TATAAATAAAAGACCTTAAAGGG - Intronic
990464059 5:56055738-56055760 TATTAATATAAGGTCTTCTATGG - Intergenic
991280988 5:64912462-64912484 TATAAAAAAAATTTCTTAAAAGG - Intronic
991327748 5:65455989-65456011 TATATATAAAATGCCTTTGATGG - Intronic
991641077 5:68753292-68753314 ATCTAATAAAAGGTCTTAGAGGG + Intergenic
992020260 5:72616650-72616672 AAAAAATAAAAAGTCTTGGATGG + Intergenic
992072820 5:73164268-73164290 TATAATTAAATGGTCTCAAATGG - Intergenic
995420119 5:111955392-111955414 TATAGATACAAGGTCCTGGATGG - Intronic
995691275 5:114829185-114829207 AAGTAATAAAAGGTCTGAGAGGG + Intergenic
995819242 5:116208532-116208554 TATAATTTTAAGTTCTTAGAAGG + Intronic
997213136 5:132089414-132089436 TATAAATCAAAGACCTTATATGG - Intergenic
998296295 5:140972408-140972430 TAAAAATAAAAGATCTTAACAGG - Intronic
998544834 5:143018329-143018351 AATATATAAAAGGGCTTTGAAGG - Intronic
1000858201 5:166426284-166426306 TTTAAACAAAAGATCATAGAAGG - Intergenic
1001590595 5:172861954-172861976 AATAAATAAAAGTTCTTGGCAGG - Intronic
1001635504 5:173207335-173207357 AATAAATAAAAGGACTTGGAAGG + Intergenic
1003151331 6:3552721-3552743 TATAAATAACAGTTCTTTGTTGG + Intergenic
1003191011 6:3874424-3874446 TATATATAAGAGGTCTTGGTGGG - Intergenic
1003803467 6:9698750-9698772 TAGAAATAAAAGTTTTGAGATGG - Intronic
1003969720 6:11287556-11287578 CATAAATAAAAAGTGTTATAAGG + Intronic
1004477014 6:15982620-15982642 TATAAAGAAAAGGTATTATTTGG - Intergenic
1004597655 6:17115701-17115723 TATAAATAAGATGACTTAAATGG - Intronic
1005118311 6:22363013-22363035 TAGAAATAAAAGCTCTTTCATGG - Intergenic
1005957152 6:30672155-30672177 TAAAAATAAAAGATATTAGCCGG + Intronic
1007410895 6:41660714-41660736 TATAAATAAAAGATTTTTAAAGG + Intergenic
1007466687 6:42057231-42057253 AATCGATAAAAGGTCTTTGATGG - Intronic
1007793727 6:44330138-44330160 GATCAATAGAAGGTATTAGATGG + Intronic
1007967811 6:46018199-46018221 TATGCATAAAATGTCTTCGAGGG + Intronic
1008207382 6:48678970-48678992 TCTAAATAAAAGGTAATATATGG + Intergenic
1008464288 6:51813467-51813489 TATAAATATAAGGCCATAGAAGG - Intronic
1008526017 6:52407859-52407881 TATAAATAAAACCTTTCAGAGGG - Intergenic
1008544027 6:52570079-52570101 TATAAGTTTAAGATCTTAGAGGG - Intronic
1009340139 6:62543860-62543882 TATAAAATAAAGTTCTTAGCTGG - Intergenic
1009447852 6:63764210-63764232 CATAAATAAAAGGTCTGGGAAGG - Intronic
1009719683 6:67451598-67451620 TATGAATAAACAGTCTTATATGG + Intergenic
1010300793 6:74256086-74256108 TATAAATCCAAAGACTTAGAAGG + Intergenic
1010793557 6:80092739-80092761 TAAAAATAAAATAACTTAGATGG - Intergenic
1011063893 6:83302770-83302792 TATAAATAAATAGTTTTAGTTGG - Intronic
1011490823 6:87890114-87890136 TATATATAAAAGCTATAAGAAGG - Intergenic
1011857811 6:91716724-91716746 TATATATTAATGGTCTTTGATGG - Intergenic
1012290236 6:97446543-97446565 TGCAAATAAAAGGTATTATAGGG - Intergenic
1012951416 6:105521914-105521936 TTTAAATAAAAGATCATACAAGG - Intergenic
1012962701 6:105639160-105639182 TATAAATAAATGGGCTTGGATGG - Intergenic
1014366384 6:120547981-120548003 TATAAACAATAGGATTTAGAAGG - Intergenic
1014645301 6:123965636-123965658 AATAAACAAAAGGTCCAAGATGG - Intronic
1016468734 6:144352722-144352744 TAAAAATAAAAGGTCGTTCAAGG + Intronic
1016509857 6:144829817-144829839 TATAAATAAAAGTTATCAGGAGG + Intronic
1016537143 6:145120525-145120547 TATAAATAAAAGATCATATATGG + Intergenic
1016554070 6:145315452-145315474 TAATAATAAAATGTCTAAGAAGG + Intergenic
1016807207 6:148223990-148224012 GAAAAATAAAAAGTCTTACATGG + Intergenic
1017280590 6:152620045-152620067 TATAAATATCAGGTCTGAGCCGG - Intronic
1017532453 6:155309537-155309559 TATGAACAAAAGATCTTTGAAGG - Intronic
1019333728 7:472848-472870 TAAAAATAAAAAGTCATAAAAGG - Intergenic
1020725662 7:11810522-11810544 AGTAAATAAAGGGGCTTAGAGGG + Intronic
1021225792 7:18024618-18024640 TATCAAGAAAAGGTATTATAGGG - Intergenic
1022573269 7:31473893-31473915 TATATAGAAAGGGTCTTAGCAGG - Intergenic
1022928383 7:35081030-35081052 TATAAAAAAAAAGTATTAAAAGG + Intergenic
1023282583 7:38586586-38586608 TAAAAATACAAGGTCTGACATGG + Intronic
1023326873 7:39070312-39070334 TAGAAATAAAAGATTTTAAAAGG - Intronic
1023655139 7:42412233-42412255 CATAAATAAAAAGTCTTTGCGGG + Intergenic
1025021053 7:55479848-55479870 CATTAATAAAAGGCCTTACATGG + Intronic
1025190957 7:56895514-56895536 TAAAAATAAAAAGTATTAGCTGG - Intergenic
1025680988 7:63681415-63681437 TAAAAATAAAAAGTATTAGCTGG + Intergenic
1026426614 7:70301007-70301029 AACAGCTAAAAGGTCTTAGAGGG - Intronic
1027289644 7:76691656-76691678 TATAAATAAAAGGCCTCTAACGG + Intergenic
1027431461 7:78117685-78117707 AAGAAATAAAAGGACTTAAAGGG + Intronic
1028901500 7:96106034-96106056 TAAAAATAAAAGGTCTTGCTAGG + Intronic
1029851673 7:103467739-103467761 TATAAATAAATGGTTATAGTTGG - Intergenic
1030481697 7:110112475-110112497 AATAAATAAAATGTTATAGATGG - Intergenic
1030832250 7:114239409-114239431 TATGAATAAAAGATATTAAAAGG - Intronic
1031877380 7:127157115-127157137 TATAGATTAAAGGTCTAACAAGG + Intronic
1032667111 7:134047703-134047725 GATAAATAAAGGGTCAGAGAAGG - Intronic
1033149752 7:138903494-138903516 TAAAAATACAGGGTTTTAGATGG + Intronic
1033373975 7:140739500-140739522 TATAAACAAAAGCTCTTTGTGGG + Intronic
1037218972 8:16493570-16493592 TAAAAAAAAAAGTTATTAGAGGG - Intronic
1037268377 8:17095589-17095611 TCTGAATAAAGGGTCTAAGAAGG - Intronic
1037430731 8:18810620-18810642 TATAAATACAGGGTCATACAGGG - Intronic
1038658893 8:29479578-29479600 TATAAATAAAAGGCTTTTGATGG - Intergenic
1038833253 8:31086901-31086923 TATACATTAAATCTCTTAGAAGG + Intronic
1039113505 8:34066266-34066288 TTTAAATAATAGGTGTCAGAAGG - Intergenic
1039534412 8:38295198-38295220 TTGGAATAAAAGGTCTTATATGG - Intronic
1039911398 8:41829537-41829559 TGTAAATACCAGGTCTTACACGG - Intronic
1040396433 8:47005168-47005190 AAAAAATAAAAGGACTTAAATGG - Intergenic
1040697538 8:50020318-50020340 TATTTACACAAGGTCTTAGATGG + Intronic
1040731087 8:50447851-50447873 TAAATATTAAGGGTCTTAGAAGG + Intronic
1040793025 8:51255968-51255990 AATAAATACCAGGACTTAGAGGG + Intergenic
1040839014 8:51764106-51764128 TAGAAATAAAAGGGATTATAAGG - Intronic
1041260567 8:56017801-56017823 CATAAATAAAATGTCACAGATGG - Intergenic
1041859691 8:62498922-62498944 TATAAATAAATGGTTTTAAGGGG - Intronic
1042014673 8:64295079-64295101 TATAAATAAAAGTTTGTTGAAGG + Intergenic
1042416389 8:68525478-68525500 TACAAATAAAATGCCTCAGAGGG - Intronic
1042769174 8:72360112-72360134 TATAACTACAAGATCTGAGATGG + Intergenic
1042802076 8:72729933-72729955 TATAAATATATGGTCTTAATGGG + Intronic
1042973741 8:74440821-74440843 TATAAAAAATAAGTCTTAGTAGG - Intronic
1043795897 8:84538876-84538898 TTTAAATAAAAAGTATTATAAGG + Intronic
1044757507 8:95480400-95480422 TATAAATGAAAGTTCCTGGATGG + Intergenic
1046157403 8:110310508-110310530 TAAAAATAAAAGATGTAAGAAGG - Intergenic
1046947057 8:119984124-119984146 TATAAAAATAAGGTCTGAAAAGG + Intronic
1046977444 8:120297281-120297303 GATAAATAAGAGGGTTTAGATGG + Intronic
1047029344 8:120860199-120860221 TATAAATAGAAGTGCTGAGAGGG + Intergenic
1047287253 8:123498100-123498122 TTTAAATGAAAAGTATTAGAGGG - Exonic
1048455239 8:134571764-134571786 TATAAATAAAAAGTATAACATGG + Intronic
1048583179 8:135747657-135747679 TATATTTTAAATGTCTTAGAAGG - Intergenic
1048619049 8:136111247-136111269 AATAAATAAGAGTTCTTATATGG - Intergenic
1049977518 9:873758-873780 AATACTTAAAAGGTATTAGAAGG - Intronic
1049990319 9:984199-984221 TGTAAATAACAGGTCCTTGATGG - Intronic
1050800230 9:9602351-9602373 TATAAATTAAATATATTAGAGGG - Intronic
1051465783 9:17376099-17376121 TAAAAATTAAAGGTGTTAAATGG - Intronic
1052490941 9:29166967-29166989 TTTTAATAAGAGGTTTTAGAAGG + Intergenic
1054728673 9:68678264-68678286 TACAAATACAAGGCCTTTGAAGG + Intergenic
1054824479 9:69558917-69558939 AATAAAAAAAGGATCTTAGAAGG + Intronic
1054941794 9:70750982-70751004 AAAAAAAAAAAGGTCTTATAAGG + Intronic
1054957117 9:70924850-70924872 TGAAAATAAGAGTTCTTAGATGG - Intronic
1054966440 9:71033126-71033148 TAAAAAGAAAGGGTCCTAGATGG + Intronic
1056161669 9:83902021-83902043 CATAAACAAAAGCTCTTTGAGGG + Intronic
1056358460 9:85827185-85827207 CATAAACAAAAGCTCTTTGAGGG - Intergenic
1056448771 9:86694055-86694077 TTCAAATAAAAGGTTATAGAAGG + Intergenic
1056715046 9:89021777-89021799 TAAAAAAGAAACGTCTTAGAGGG - Intronic
1057926883 9:99160238-99160260 AATTAATACAAGGGCTTAGAGGG - Intergenic
1058095235 9:100852808-100852830 AATAAATAAATGGTATTTGATGG + Intergenic
1058300426 9:103364714-103364736 AATAAATAAAATGTTTTAAAAGG - Intergenic
1058807934 9:108610482-108610504 TATGAATTTTAGGTCTTAGAAGG + Intergenic
1059928568 9:119238004-119238026 AATAAATAAAAGGTTTCTGATGG - Intronic
1060189017 9:121580616-121580638 AAAAAAAAAAAGTTCTTAGATGG - Intronic
1186583509 X:10846838-10846860 AATGAAGAAAAGGTCTTAGCTGG + Intergenic
1186700530 X:12085259-12085281 TATAATTTAAATGTCTGAGAGGG + Intergenic
1186776330 X:12868350-12868372 TATCAATAAAATGACTTAGCAGG + Intronic
1187401942 X:18967938-18967960 TATAAACAAAAGCTCTTAGGGGG - Intronic
1188548533 X:31336783-31336805 TATAAGTAGAAGGTGTTAGGTGG + Intronic
1188850252 X:35123518-35123540 TATACATAAAAGTCCATAGAGGG + Intergenic
1189307284 X:39996362-39996384 AATAAATAAAAAGTGTTTGAAGG + Intergenic
1189642184 X:43085216-43085238 TATAAATAAAATGGTTTAGCTGG + Intergenic
1190024126 X:46907105-46907127 TATAAATTCAACGACTTAGATGG + Intergenic
1190400907 X:50033809-50033831 TATAAATAAAAGCTCTTTAAGGG + Intronic
1190681156 X:52828165-52828187 TATAAATAAAAAGTTTTGGCCGG + Intergenic
1190682030 X:52834549-52834571 TAACAATAAAAGATCTTACAGGG + Intergenic
1193680556 X:84514272-84514294 TAAAAAAAAAAGGTCTTATCAGG + Intergenic
1195649461 X:107269898-107269920 TAGAAATAAAAAGTATTATATGG + Intergenic
1196935266 X:120724286-120724308 AAGAAATAAAAGGTCTTAAAAGG - Intergenic
1198530066 X:137543845-137543867 TAGAAATGAAAGGGCTTATAGGG + Intergenic
1198993693 X:142547675-142547697 TATAAATAAAAGACCTTGGATGG - Intergenic
1199676297 X:150192176-150192198 CATAAACAAAAGGTCTTTGGAGG - Intergenic
1200316731 X:155141052-155141074 GCTAAATAGAAAGTCTTAGAGGG + Intronic
1202587015 Y:26441568-26441590 TATTATTAAAATGTCATAGAAGG - Intergenic