ID: 957118392

View in Genome Browser
Species Human (GRCh38)
Location 3:76057156-76057178
Sequence TTGAAGCACGTATAAATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957118392_957118395 -1 Left 957118392 3:76057156-76057178 CCTTTTATTTATACGTGCTTCAA 0: 1
1: 0
2: 4
3: 33
4: 326
Right 957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG 0: 1
1: 0
2: 0
3: 0
4: 30
957118392_957118394 -2 Left 957118392 3:76057156-76057178 CCTTTTATTTATACGTGCTTCAA 0: 1
1: 0
2: 4
3: 33
4: 326
Right 957118394 3:76057177-76057199 AATCTGATACTAGGCGTATGCGG 0: 1
1: 0
2: 0
3: 5
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957118392 Original CRISPR TTGAAGCACGTATAAATAAA AGG (reversed) Intronic
900864171 1:5255504-5255526 TTGATGAATGGATAAATAAATGG - Intergenic
901331526 1:8413097-8413119 TTCACGCATGTATAAATAATAGG - Intronic
901649806 1:10737084-10737106 ATGGAGCAGGGATAAATAAATGG - Intronic
903633174 1:24792681-24792703 TTCATGCACACATAAATAAAAGG - Intronic
904657438 1:32059827-32059849 TTGAAGCCTCTATAAACAAAGGG - Intronic
905713802 1:40130848-40130870 TTAAAGCAGATCTAAATAAATGG - Intergenic
906977004 1:50586562-50586584 TTGTTGCATGAATAAATAAATGG + Intronic
906977408 1:50590294-50590316 TTAAAGAAGATATAAATAAATGG - Intronic
907004494 1:50897155-50897177 TTAAAGAATATATAAATAAATGG + Intronic
907147637 1:52250256-52250278 TTAAAGAACATACAAATAAATGG - Intronic
907426922 1:54385620-54385642 TAGAAGCACGAATAAGTAAGAGG - Intronic
907680363 1:56557539-56557561 TTGATACACGTATAATTAAGTGG + Intronic
907681314 1:56566690-56566712 GTGAAGCACCTAACAATAAATGG + Intronic
908084417 1:60615341-60615363 TTGAAGAAGATACAAATAAATGG - Intergenic
908968004 1:69788971-69788993 TTGTAGCAAGTATCAATAAATGG + Intronic
909230034 1:73076649-73076671 TTAAAGAATTTATAAATAAATGG + Intergenic
909716120 1:78708902-78708924 TTGAAACAGATACAAATAAATGG + Intergenic
910249163 1:85176710-85176732 CTGAAGCATCTATAAATGAAAGG + Intronic
910574533 1:88745583-88745605 TTGAAGATGGTACAAATAAATGG + Intronic
910606843 1:89095653-89095675 TTGAAGAAGACATAAATAAATGG + Intergenic
910750971 1:90630172-90630194 TTGAAGAACCAAGAAATAAATGG + Intergenic
911223161 1:95273716-95273738 TTGAAGAGGGTATAAACAAATGG + Intergenic
911463835 1:98225579-98225601 TAGAAGGATGTATAAATCAAAGG - Intergenic
911719153 1:101171253-101171275 TAAAAGCATGTATAAAGAAAAGG - Intergenic
912016588 1:105045026-105045048 TTGAAGAAGGTATAAATAAATGG + Intergenic
912596600 1:110884892-110884914 ATGAAGCAGGAATAAATAGATGG - Intronic
912910284 1:113752156-113752178 TTAAAGAAGGTCTAAATAAATGG - Intronic
913308649 1:117461720-117461742 TTGAAGAGGATATAAATAAATGG + Intronic
915700543 1:157789954-157789976 TTGAAGAAGATACAAATAAATGG + Intergenic
915975520 1:160384636-160384658 TTAAAGAAGGTCTAAATAAATGG - Intergenic
916379518 1:164194235-164194257 TTGAAGCATACATAAAAAAATGG + Intergenic
916575818 1:166065546-166065568 GTAAAGCACTTATACATAAAGGG + Intronic
917152436 1:171959462-171959484 TTGAAGCACATCTAAACAGATGG + Intronic
917239255 1:172929733-172929755 TTGAAGCATGTACAGAGAAAAGG + Intergenic
918566721 1:185942824-185942846 ATCAAGCAGGTATAAATCAAGGG + Intronic
919348053 1:196411522-196411544 TTGAAGGAGACATAAATAAATGG - Intronic
920025942 1:202996526-202996548 TTAAAGAAAGCATAAATAAATGG + Intergenic
920735678 1:208531210-208531232 TTGAAGCAGGAAGAAATCAAAGG + Intergenic
924228841 1:241946223-241946245 TTGAAGCACTTCTAAAGAAATGG - Intergenic
924249616 1:242118274-242118296 TTGAAGCTCAAATAAATGAATGG + Intronic
1065083430 10:22150081-22150103 TTGAATGAGGTAAAAATAAATGG - Intergenic
1065401737 10:25310535-25310557 TTAAAGAAAGCATAAATAAATGG - Intronic
1068224908 10:54095374-54095396 TTGAAGTAAGTGTAAGTAAAAGG + Intronic
1068462055 10:57341694-57341716 TGGAAGCATGTATAAATAACAGG + Intergenic
1068909679 10:62365837-62365859 TAGCATCATGTATAAATAAATGG + Intergenic
1070226383 10:74511447-74511469 TTGAAGTGCATACAAATAAATGG - Intronic
1071955063 10:90748971-90748993 TTGAAGAAGGCATATATAAAAGG + Exonic
1072356693 10:94618428-94618450 TTGAAGAACGAATAAATAAAAGG - Intergenic
1073336141 10:102711081-102711103 TTGAAAGACGTAAAAACAAATGG - Intronic
1073665392 10:105526733-105526755 TAAAAGCAAATATAAATAAATGG + Intergenic
1076286557 10:129304133-129304155 TTAAAGAACATCTAAATAAATGG + Intergenic
1076800294 10:132819246-132819268 TTGAAGGAGACATAAATAAATGG + Intronic
1079326709 11:19499229-19499251 TTGAAGGTACTATAAATAAAAGG + Intronic
1081516389 11:43834628-43834650 TTAAAGCACTTATAAAATAAAGG + Intronic
1082662530 11:55929799-55929821 TTGAAGAAGATACAAATAAATGG - Intergenic
1083104595 11:60345820-60345842 TGGAGGCATGTATAAATAATAGG + Intronic
1085820306 11:79785700-79785722 TTGAAGAAGTTCTAAATAAATGG + Intergenic
1086385000 11:86298080-86298102 TTAAAGGACATCTAAATAAATGG - Intergenic
1086844989 11:91737860-91737882 TTAAAGCAAAAATAAATAAATGG + Intergenic
1088096874 11:106111240-106111262 ATGAAGCTCCTAAAAATAAAAGG + Intergenic
1088217626 11:107530405-107530427 TTAAAACATGTATAAATAACAGG - Intronic
1088445705 11:109925210-109925232 TTGAAGAAGGCACAAATAAATGG - Intergenic
1088766519 11:112985556-112985578 TTGAAGAAGGCACAAATAAATGG - Intronic
1088979618 11:114850339-114850361 TGGCAGCACGTTTAAATAACTGG - Intergenic
1090494954 11:127202568-127202590 TTGAAAAAGGTATAAATAAATGG + Intergenic
1092895092 12:13002633-13002655 TTGAAGAAGGCATAAATAAAAGG - Intergenic
1093206116 12:16252647-16252669 TTGAAGAATATACAAATAAATGG + Intronic
1093674572 12:21922213-21922235 TTGAAGAAGATACAAATAAATGG - Intronic
1094005832 12:25750068-25750090 TAGAAGAATGGATAAATAAATGG + Intergenic
1095646119 12:44549738-44549760 TTAAAGTAGATATAAATAAATGG + Intronic
1096566357 12:52484334-52484356 TTGAAGAACATACAAACAAATGG - Intergenic
1097367793 12:58739329-58739351 TTAAAGCAGATACAAATAAATGG + Intronic
1098283485 12:68884862-68884884 TTGTAGAACCTAAAAATAAAAGG + Intronic
1098405131 12:70116954-70116976 CTGATGAACGGATAAATAAAAGG + Intergenic
1098665551 12:73158224-73158246 GTGAGGAATGTATAAATAAATGG - Intergenic
1098798744 12:74926038-74926060 TTGAAGAAGACATAAATAAATGG + Intergenic
1098927372 12:76365292-76365314 TTAAAGAACATCTAAATAAAGGG - Intronic
1099554125 12:84088657-84088679 TTAAAGAAGATATAAATAAATGG - Intergenic
1100165336 12:91911336-91911358 TAGAAGCAAGGAAAAATAAAGGG - Intergenic
1100413726 12:94349990-94350012 TTAAAGAAGATATAAATAAATGG + Intronic
1100424197 12:94467768-94467790 TTAAAGAAGATATAAATAAATGG + Intergenic
1101616278 12:106341005-106341027 TTGAAGCAGAAATCAATAAAAGG - Intronic
1104520368 12:129468777-129468799 TTGGAGCACTTAGAAATATATGG - Intronic
1105538129 13:21288923-21288945 TTCAAGAAAGCATAAATAAATGG - Intergenic
1105797968 13:23875932-23875954 TTGAAGAACGTTTAAAGACATGG - Intronic
1108744345 13:53376237-53376259 CTGAAACATGTATAAATAAAAGG - Intergenic
1109427802 13:62190261-62190283 TTGAAGAAGACATAAATAAATGG + Intergenic
1109638371 13:65153238-65153260 TTGATGAATGGATAAATAAAAGG - Intergenic
1110160464 13:72371393-72371415 TTGAAGAAGGCATAAATAAATGG - Intergenic
1110652298 13:77956171-77956193 TTAAAGCACACACAAATAAATGG - Intergenic
1111685556 13:91497020-91497042 TTTTTGCACGTATATATAAAAGG - Intronic
1112049013 13:95626860-95626882 TTGAAGAACACTTAAATAAATGG + Intronic
1113382380 13:109815678-109815700 TTGAAATATTTATAAATAAAAGG + Intergenic
1113648727 13:112017519-112017541 TTGAAGAAGATACAAATAAATGG - Intergenic
1113881023 13:113626361-113626383 TTCAAGCATATTTAAATAAACGG - Intronic
1114593185 14:23888076-23888098 TTGAAGAATATACAAATAAATGG + Intergenic
1115011281 14:28548436-28548458 TTGAAGAAAATCTAAATAAATGG - Intergenic
1115419602 14:33179122-33179144 TTGAAGCACCTTTAAATTACTGG + Intronic
1115578072 14:34730660-34730682 TTGAAGAAGATAAAAATAAATGG - Intergenic
1116016160 14:39409722-39409744 TTAAAGCAGATACAAATAAATGG - Intronic
1116069734 14:40028258-40028280 TGGAAGCAAATAGAAATAAAAGG + Intergenic
1116086057 14:40239209-40239231 TTGAAGGAAATATAAATAAATGG + Intergenic
1116111245 14:40586817-40586839 TTGAAGCACGTCTTAATAAAGGG - Intergenic
1117902291 14:60547596-60547618 TTGAAGAAGATATAAACAAATGG - Intergenic
1118145653 14:63132571-63132593 TTGAAGAAGGCACAAATAAATGG + Intergenic
1118675129 14:68176013-68176035 TTGCTGCACTCATAAATAAATGG + Intronic
1118986193 14:70757118-70757140 TTAAAGGAGGTCTAAATAAATGG + Intronic
1120353822 14:83401661-83401683 TTGAAGTATGTATATACAAATGG + Intergenic
1120730919 14:88000512-88000534 TTGAAGAAGGCACAAATAAATGG - Intergenic
1123773282 15:23550733-23550755 TTAAAGCAGATACAAATAAAAGG - Intergenic
1123952184 15:25290705-25290727 TTGAAGCACCTAAATATATAAGG + Intergenic
1124195363 15:27621356-27621378 TTGGAGGAGGTATAAATGAAGGG - Intergenic
1126281281 15:46953202-46953224 TTAAAGCAAAGATAAATAAATGG + Intergenic
1126972760 15:54135993-54136015 TTGAAGAAAACATAAATAAATGG - Intronic
1127220794 15:56878660-56878682 TTGAAGCAGATATAAATAGATGG + Intronic
1128035857 15:64525716-64525738 TTAAAGAAGTTATAAATAAATGG - Intronic
1128736238 15:70055508-70055530 TTGAAGCAAGGATATATAACTGG - Intronic
1129123530 15:73418642-73418664 CTGATGCATGGATAAATAAAAGG + Intergenic
1131560423 15:93434911-93434933 ATGAAGCCTTTATAAATAAAGGG + Intergenic
1134422048 16:14102645-14102667 TTAAAGCAAGTATAAACACATGG - Intronic
1143143952 17:4761118-4761140 TCGAAGAAGATATAAATAAATGG - Intergenic
1143878533 17:10012129-10012151 TTGAAGCCAGTATAGATAGATGG - Intronic
1149869173 17:60167523-60167545 TTGCAGCACGAGTGAATAAAAGG + Intronic
1150059453 17:62052536-62052558 ATGAAAAACCTATAAATAAAAGG - Exonic
1150751319 17:67865244-67865266 TTAAATCACAGATAAATAAAAGG - Intronic
1153080095 18:1212671-1212693 TTGAAGAGCATATAAATAAATGG - Intergenic
1153190208 18:2529680-2529702 TTGAAAGACATATAAATTAATGG + Intergenic
1153369845 18:4302863-4302885 TTGAAGAAGACATAAATAAATGG - Intronic
1153895420 18:9554787-9554809 TTGATGCACTTAAAAATCAAAGG + Intronic
1154495592 18:14957309-14957331 TAGAAGCATGTATTAAAAAAAGG - Intergenic
1155178341 18:23321337-23321359 TTTTTGCACGTATAAAAAAAGGG - Intronic
1155763330 18:29593615-29593637 TTGAAGAAGATACAAATAAATGG + Intergenic
1156493554 18:37511091-37511113 TTGAATGATGAATAAATAAAGGG + Intronic
1157879752 18:51309779-51309801 TTGAAGAAGATATAAAAAAAGGG + Intergenic
1158282902 18:55847504-55847526 TTGAGGCACAAAAAAATAAAAGG - Intergenic
1158810889 18:61032824-61032846 TTGAAGTATGTCTCAATAAAAGG - Intergenic
1159433010 18:68380713-68380735 TTTAAGGAAGTAGAAATAAAGGG + Intergenic
1159661662 18:71104396-71104418 TTAAAGGAGGCATAAATAAAGGG - Intergenic
1159910374 18:74139947-74139969 TTGAAGAACGTTTTAATAAAAGG + Intronic
1160068511 18:75602500-75602522 TTGAAGCATGAAGAAATAGAAGG + Intergenic
1161889261 19:7022611-7022633 TTGAAGAGAGAATAAATAAATGG + Intergenic
1161892191 19:7048136-7048158 TTGAAGAGAGAATAAATAAATGG - Intergenic
1164409582 19:27989626-27989648 ATGGAGCAGGTGTAAATAAAAGG - Intergenic
1168387572 19:55978399-55978421 TTGCATGACGTATAAAGAAAAGG + Intronic
930737930 2:54798771-54798793 ATAAAGCAAGAATAAATAAAAGG - Intronic
931142372 2:59476941-59476963 TTGAAGAAGATACAAATAAATGG + Intergenic
932267505 2:70381065-70381087 TTAAAGAAGGTCTAAATAAATGG - Intergenic
932865044 2:75333028-75333050 TGAAATAACGTATAAATAAAAGG - Intergenic
936253783 2:110890930-110890952 TTAAAGAAGGTCTAAATAAATGG - Intronic
936637163 2:114272031-114272053 TTCAAGCACTTATGCATAAATGG - Intergenic
937164681 2:119801548-119801570 TTGAAGAAAATCTAAATAAATGG - Intronic
937652755 2:124338786-124338808 TTGGAGCACTTTGAAATAAAGGG - Intronic
938129495 2:128700226-128700248 TTGAAGAAGACATAAATAAATGG + Intergenic
939659828 2:144875016-144875038 TTGAGGTACCTAAAAATAAAAGG + Intergenic
939743602 2:145941210-145941232 TTTAAGGACTAATAAATAAAAGG - Intergenic
941030273 2:160502968-160502990 TTTGAGCACCTAGAAATAAAAGG - Intergenic
941040511 2:160616807-160616829 TAGAAGAAAGTATAAATACAAGG + Intergenic
941223780 2:162819297-162819319 TTGAAGCATTTAAAAATGAAGGG + Intronic
941545034 2:166839008-166839030 TTCAAGCATTTTTAAATAAATGG - Intergenic
941833495 2:169989690-169989712 TTTGAGCACCTGTAAATAAAAGG - Intronic
942831369 2:180240047-180240069 TTGAAGGACACATAAATGAATGG + Intergenic
942845364 2:180418052-180418074 TTGAAGCACAGATAATAAAATGG + Intergenic
942923755 2:181408718-181408740 TTAAAGCAAATAAAAATAAAAGG + Intergenic
943218912 2:185078447-185078469 TTGAAGAAGATACAAATAAATGG + Intergenic
943236607 2:185329139-185329161 GTGAAGCATGTATAGACAAATGG - Intergenic
944284809 2:197937421-197937443 TTGAAGAAGACATAAATAAATGG - Intronic
944812084 2:203337484-203337506 TTGAAGAACATGCAAATAAATGG + Intronic
945385723 2:209198365-209198387 TTGAAGAAGACATAAATAAAAGG + Intergenic
945462502 2:210126308-210126330 TTAAAGAAGATATAAATAAATGG + Intronic
946408174 2:219503437-219503459 TTAAAGCACGAACAAATAAAAGG - Intronic
948498921 2:238376585-238376607 TTAAAGCAAGTCTAAATAAATGG - Intronic
1170340285 20:15319300-15319322 TTCAAGAAGCTATAAATAAATGG + Intronic
1170462794 20:16594157-16594179 TTGAAGAAGGCACAAATAAATGG + Intergenic
1171153603 20:22850517-22850539 TTGAAGAAGATATACATAAATGG + Intergenic
1173754375 20:45502379-45502401 TTGAAGCTTGTTTAAATAAATGG + Intergenic
1174703041 20:52628415-52628437 TTGAAGTAAGTATAAATAGAAGG + Intergenic
1179362815 21:40728162-40728184 TTGAAGCAAGTATAACAAATAGG - Intronic
1182069333 22:27452444-27452466 TGGATGCACGGATAAATAAGTGG + Intergenic
1182086659 22:27565610-27565632 TGGAAGCAAGGAAAAATAAATGG + Intergenic
1183374564 22:37455657-37455679 TTGATGCAAGTAAAAATAAGTGG + Intergenic
1183852637 22:40603971-40603993 TTGAAACACATATAAAAACAAGG - Intronic
1184216561 22:43071319-43071341 TTGAAAAACTGATAAATAAAGGG - Intronic
949335160 3:2966788-2966810 ATGAAGAAAGAATAAATAAAAGG + Intronic
951140788 3:19156103-19156125 TTGAACCACGTGAAAATAAGAGG - Intronic
952624403 3:35386814-35386836 TTGGAGCACTTAGAAAAAAATGG - Intergenic
952656141 3:35787804-35787826 TAGAAGAATGTATAAATAAATGG + Intronic
953513253 3:43565098-43565120 TTGAACCAGTTATAAGTAAATGG - Intronic
954159673 3:48711996-48712018 TTAAAGCACATCTAAACAAATGG + Intronic
956925677 3:73985480-73985502 TTAAAGAAGGTATAAATAAATGG + Intergenic
957118392 3:76057156-76057178 TTGAAGCACGTATAAATAAAAGG - Intronic
957935841 3:86941113-86941135 TTGAAGTACATATATTTAAAGGG - Exonic
960014648 3:112872591-112872613 TTGAAGAAAGTATAAATAAATGG - Intergenic
960651633 3:119957840-119957862 TTCAAGCACATAGTAATAAATGG - Intronic
960834486 3:121891205-121891227 TTGAAGAAGATCTAAATAAATGG - Intergenic
964049641 3:152374696-152374718 CTGAAACATGTAAAAATAAATGG + Intronic
964377408 3:156062685-156062707 TTGAAGAACACCTAAATAAATGG - Intronic
964514233 3:157490053-157490075 TTTAAAAACATATAAATAAAGGG + Intronic
965781443 3:172290140-172290162 TGGTAGCACCTCTAAATAAAAGG + Intronic
966034605 3:175396515-175396537 TTGAAGCACACATAACCAAATGG + Intronic
967720672 3:192812879-192812901 GTGGAGAACCTATAAATAAATGG + Intronic
968241380 3:197089654-197089676 TTTAATCAAGTACAAATAAAAGG + Intronic
968340331 3:197950323-197950345 TTGAAACCCGTAGAAATCAATGG - Intronic
969625170 4:8299131-8299153 TTAAAGAAGATATAAATAAATGG - Intronic
970051182 4:11916739-11916761 TTGGAGAACTAATAAATAAAAGG + Intergenic
970683008 4:18533086-18533108 TGGAAGAAAGTATAAACAAAAGG + Intergenic
971446990 4:26761349-26761371 TTAAAGCAGATCTAAATAAATGG - Intergenic
971547134 4:27900233-27900255 TGCAAGTATGTATAAATAAAAGG - Intergenic
971874171 4:32283715-32283737 TTGAAGAAGATCTAAATAAATGG + Intergenic
971953517 4:33385135-33385157 TTGAAGAAGATATAAATAAATGG + Intergenic
972038542 4:34558385-34558407 TTGAAGAAGTTACAAATAAATGG + Intergenic
973796865 4:54436191-54436213 TTGCAACATGTATAAATAATTGG + Intergenic
973917224 4:55647722-55647744 TTTAAGCACATATGCATAAATGG + Intergenic
974359764 4:60862130-60862152 TTAAAGTAGGCATAAATAAATGG + Intergenic
975200160 4:71577995-71578017 TTGAAGGAGGCACAAATAAATGG + Intergenic
975224177 4:71851095-71851117 TTGAAGAAGATACAAATAAATGG - Intergenic
979430781 4:120627693-120627715 TTGAAGCAGACACAAATAAATGG + Intergenic
979515264 4:121601658-121601680 TTGAAGCAAATATCTATAAAGGG + Intergenic
979754222 4:124320166-124320188 TTAAAGAAGATATAAATAAATGG - Intergenic
980163482 4:129196268-129196290 TTGAAAAACATCTAAATAAATGG - Intergenic
980687181 4:136243233-136243255 TTGAAGAAAATACAAATAAATGG + Intergenic
982013638 4:151130633-151130655 TTGAGAAACGTATAAAGAAATGG + Intronic
982916410 4:161215052-161215074 TTGAAGAAGATACAAATAAATGG - Intergenic
983142353 4:164167272-164167294 TTGAAGAAGATACAAATAAATGG + Intronic
983230268 4:165122818-165122840 TTGCAGCATATATAAATCAATGG - Intronic
983468120 4:168121404-168121426 TTGAAGAAAGTTAAAATAAACGG - Intronic
983703420 4:170626943-170626965 TTGAAGGATATATAAATAAGTGG - Intergenic
983715699 4:170778683-170778705 TTGAAGCAATTATAGAAAAATGG + Intergenic
983729296 4:170973494-170973516 TTGAAGGAGATAGAAATAAATGG - Intergenic
986263562 5:6172211-6172233 CTGAAGAACACATAAATAAATGG + Intergenic
986932771 5:12847575-12847597 TTGAAGAAAATATAGATAAATGG + Intergenic
987557217 5:19468788-19468810 TTGAAGCACTGATGAAAAAATGG - Intergenic
987607292 5:20153720-20153742 TTGATGCATGTATAAAGGAAAGG - Intronic
988095233 5:26598543-26598565 TTAAAGAAGGTATAAATAAATGG - Intergenic
989689211 5:44120372-44120394 TTGAAACACATACAAATGAAAGG + Intergenic
990194613 5:53300788-53300810 TTGAAGCTGTTAGAAATAAAAGG + Intergenic
990741554 5:58917647-58917669 TTGAAGGACATATAAAGAGAAGG - Intergenic
991273184 5:64810544-64810566 TTGAAGAAGGCACAAATAAATGG - Intronic
992186995 5:74253729-74253751 TTGAAGCAGACACAAATAAATGG + Intergenic
993594679 5:89838484-89838506 TTGAATCACATATACATACATGG - Intergenic
994015866 5:94964511-94964533 TTGGAGCACCTACAAATATAGGG - Intronic
994781289 5:104094061-104094083 TTGAACCAAGTAGAATTAAATGG - Intergenic
995620219 5:114017770-114017792 TAAATGCACATATAAATAAATGG - Intergenic
996521663 5:124434254-124434276 TTGAAGAAGATAAAAATAAATGG + Intergenic
996890893 5:128418652-128418674 TTGAAAAATGTACAAATAAATGG - Intronic
998535039 5:142922094-142922116 TTGAAGCATGTATCAACAACAGG - Intronic
999050238 5:148516093-148516115 TTGAAGCACATAGAGATAAATGG - Intronic
999555509 5:152738191-152738213 TTGAGGCAGATTTAAATAAATGG - Intergenic
1000657815 5:163902834-163902856 TTGAAGAAGATACAAATAAATGG + Intergenic
1002148884 5:177209952-177209974 TTGAAGCACATAAAGATGAACGG + Exonic
1003969544 6:11285336-11285358 TTAAAGAAGATATAAATAAATGG + Intronic
1004778114 6:18871974-18871996 TTGCAGCACATATCAATAAAAGG - Intergenic
1004790646 6:19022471-19022493 TTGAAGCAGGTATGAGAAAAGGG - Intergenic
1004849663 6:19685585-19685607 TTAAAGAAAGTATAAATAAATGG + Intergenic
1006747539 6:36354798-36354820 TTAAAGCAAATCTAAATAAATGG - Intronic
1008681075 6:53873098-53873120 TTGAAGAGGATATAAATAAATGG - Intronic
1008846837 6:55976553-55976575 TTGAAGAAGATCTAAATAAATGG - Intergenic
1009552940 6:65123058-65123080 ATAAAGCTCATATAAATAAAGGG + Intronic
1009654927 6:66531251-66531273 ATGAAGCAAGAAGAAATAAAAGG + Intergenic
1009714032 6:67364039-67364061 TGGAAGGAAGTAAAAATAAAAGG - Intergenic
1009764047 6:68045813-68045835 TTGAAGAAGATATAAATAAATGG - Intergenic
1009808400 6:68631469-68631491 TTGAAGTACTAAAAAATAAAGGG - Intergenic
1010180427 6:73080556-73080578 TTGATTAATGTATAAATAAAAGG - Intronic
1011300736 6:85870462-85870484 TTAAAGGAAATATAAATAAATGG - Intergenic
1012293295 6:97486062-97486084 TTGAAGAAAGCACAAATAAATGG - Intergenic
1012603764 6:101131831-101131853 TTAGAACAGGTATAAATAAAAGG - Intergenic
1013181932 6:107724621-107724643 TTAAAGAAGATATAAATAAATGG + Intronic
1014034163 6:116746033-116746055 TTGAAGAAGACATAAATAAATGG - Intergenic
1014401975 6:121000822-121000844 TTGAAGCAAGTAAAAAACAATGG + Intergenic
1014700050 6:124674507-124674529 TTAAAGAAGATATAAATAAATGG - Intronic
1014862984 6:126493480-126493502 TTGAAGAAGATACAAATAAATGG - Intergenic
1015073641 6:129128643-129128665 TTGAAGAAGGCATGAATAAATGG - Intronic
1015343059 6:132124404-132124426 TGGAAGCATGTATAAATCTATGG - Intergenic
1016283719 6:142449221-142449243 TTTAATCACTTGTAAATAAATGG + Intergenic
1016763582 6:147767579-147767601 TTGAAGCCCTTATAAAGAAATGG + Intergenic
1017018684 6:150122659-150122681 TTGAAGAAGATACAAATAAATGG - Intergenic
1017803632 6:157923291-157923313 TAGCAGCTCGTGTAAATAAATGG + Intronic
1019149574 6:169995441-169995463 TTGAAGAAGGCACAAATAAATGG + Intergenic
1019546114 7:1577402-1577424 TAGAAGAATGGATAAATAAACGG - Intergenic
1020332500 7:7033755-7033777 TTGAAGAAGATACAAATAAATGG - Intergenic
1020474202 7:8576472-8576494 TTGAAGTACGTTTGAATGAAAGG + Intronic
1020726100 7:11817009-11817031 TTAAAGAATGTACAAATAAATGG + Intronic
1021388460 7:20061914-20061936 TTAAAGCAGATTTAAATAAATGG + Intergenic
1022774254 7:33508596-33508618 ATGAAGCACGTGTATAAAAAGGG - Intronic
1024475893 7:49810385-49810407 TCAAAGGACATATAAATAAATGG + Intronic
1024489881 7:49968259-49968281 TTTAAACAGATATAAATAAAAGG + Intronic
1026599000 7:71758279-71758301 TTGAAGAAGGCACAAATAAATGG - Intergenic
1027425926 7:78061510-78061532 TTGAATCACCTATTAATTAAGGG - Intronic
1027502323 7:78968392-78968414 TTGAAGAAGACATAAATAAATGG - Intronic
1027681300 7:81224189-81224211 TTGAAGCAGACACAAATAAAAGG - Intergenic
1027786624 7:82587637-82587659 TTGAAGAAGATATTAATAAATGG - Intergenic
1027836014 7:83243857-83243879 TTAAAGAACTTATAAATAAATGG - Intergenic
1028434972 7:90792807-90792829 TTGAAGCAATTTTAAATAAGGGG - Intronic
1031553293 7:123142002-123142024 TTGAAGGAAGTAGAGATAAAAGG - Intronic
1031616243 7:123884550-123884572 TTAAAGCAAGTATTAATAAAAGG + Intergenic
1031695477 7:124847082-124847104 CTGAAGAAAATATAAATAAATGG + Intronic
1033055511 7:138049416-138049438 TTGAAGGAGATTTAAATAAATGG + Intronic
1033896404 7:146075830-146075852 TTGAAGCCAGTATACATGAAAGG + Intergenic
1034518040 7:151596781-151596803 TTGAAGAAGATACAAATAAAAGG + Intronic
1034917114 7:155049540-155049562 GTGACGCACGCATAAATATACGG - Intergenic
1036221805 8:6927521-6927543 TTAAAGAATGTAAAAATAAATGG - Intergenic
1036964806 8:13284877-13284899 TTGAAGAAGATCTAAATAAATGG + Intronic
1037224312 8:16566026-16566048 TTGAAGCACATTTATAAAAAGGG - Intronic
1039266957 8:35835802-35835824 TTGAAGAAAATATAAATACATGG + Intergenic
1039337644 8:36610341-36610363 TTGAAACAAGTATAGATAAATGG - Intergenic
1042015953 8:64311696-64311718 CTGAAGCACACAGAAATAAAAGG + Intergenic
1042096580 8:65222587-65222609 TTTAAGCAATTATAAACAAAAGG + Intergenic
1042178091 8:66057200-66057222 TTGAAGCAAGTAAAAAAAAATGG + Intronic
1042292782 8:67187063-67187085 TTGAAGGACTACTAAATAAATGG + Intronic
1043232177 8:77816992-77817014 TTGAAGCATGGACAAATGAATGG + Intergenic
1043715254 8:83476037-83476059 TTGAAGGAGCCATAAATAAATGG + Intergenic
1044608530 8:94069380-94069402 ATGAAGCTCTTATAAATTAATGG - Intergenic
1044911279 8:97062213-97062235 TTCAAGCACCTTTAAAGAAAAGG - Intronic
1046204222 8:110969700-110969722 TTGATGCATGTACAGATAAATGG + Intergenic
1047525440 8:125629582-125629604 TTGAAGAGGATATAAATAAATGG + Intergenic
1048382275 8:133876657-133876679 TTAAAGAAGATATAAATAAATGG - Intergenic
1048742097 8:137572553-137572575 TTTAAGCCAGTATAAGTAAATGG + Intergenic
1048888448 8:138927597-138927619 TGGAAGCACGTTTAAAGAAATGG - Intergenic
1049490178 8:142894199-142894221 TTAGAGCACCTCTAAATAAAGGG - Intronic
1049840775 8:144770036-144770058 TTAAAGAACACATAAATAAATGG + Intergenic
1049991277 9:994047-994069 TTGCAGCACGTAGAATTCAAGGG + Intergenic
1050409364 9:5346803-5346825 TTAAAGCAAAAATAAATAAATGG + Intergenic
1050438648 9:5636201-5636223 CTGAAGAAGGTACAAATAAATGG - Intronic
1051404044 9:16714955-16714977 TTGAAGCAGGTATAAAATATTGG + Intronic
1052437443 9:28446609-28446631 TTGGAGCACGTAATAACAAAAGG - Intronic
1052448347 9:28592542-28592564 TTGAAGCACAGCTGAATAAATGG + Intronic
1052567006 9:30167601-30167623 TTGAAGAAGATATAAATAAATGG + Intergenic
1052872985 9:33525334-33525356 TACAAACACATATAAATAAATGG + Intronic
1055342487 9:75299164-75299186 ATGAAGCATGGAGAAATAAAAGG - Intergenic
1055362439 9:75507601-75507623 TTAAAGAAGATATAAATAAATGG - Intergenic
1056784263 9:89578550-89578572 TTAAAGAAGGTCTAAATAAATGG - Intergenic
1057273097 9:93661624-93661646 TGGAAGGACGAATAAATGAATGG + Intronic
1057628288 9:96698428-96698450 TTCAAGCAAACATAAATAAATGG + Intergenic
1057684443 9:97220379-97220401 TAAAAACACATATAAATAAATGG - Intergenic
1057833995 9:98429523-98429545 TTGAAGCAGTTCTCAATAAAAGG - Intronic
1058280321 9:103104982-103105004 TTGAAACACTTAAAAAAAAAAGG - Intergenic
1061018756 9:128000019-128000041 TTAAAGAAGGCATAAATAAATGG - Intergenic
1187066870 X:15849563-15849585 ATCAAGCACCTTTAAATAAAAGG - Intronic
1187751321 X:22468536-22468558 TTGAAGAAGATACAAATAAATGG - Intergenic
1188170657 X:26920170-26920192 TTGAAGAAGATACAAATAAATGG + Intergenic
1188854765 X:35180064-35180086 TTAAAGAATGCATAAATAAATGG + Intergenic
1188995176 X:36875995-36876017 TTGAAGAAGGCACAAATAAATGG + Intergenic
1189727445 X:43982342-43982364 TTGAGGCAAGAAAAAATAAAAGG + Intergenic
1189926211 X:45958358-45958380 TTGAAACCTGTAAAAATAAAAGG + Intergenic
1190583620 X:51914393-51914415 TTGAAGAAGATACAAATAAATGG - Intergenic
1191163582 X:57362816-57362838 ATGAAGTACCTATCAATAAATGG - Intronic
1191730963 X:64335011-64335033 GTGAAGGAAGAATAAATAAATGG + Intronic
1193533362 X:82683658-82683680 TTGAAGAAGACATAAATAAATGG - Intergenic
1193843804 X:86443206-86443228 TTGAAGAAGGCACAAATAAATGG - Intronic
1194128321 X:90047682-90047704 TTGAAGCTAGTATAGTTAAATGG + Intergenic
1194285362 X:92004173-92004195 TTGAAACCTATATAAATAAATGG - Intronic
1194499659 X:94665568-94665590 TTGAAGAACACCTAAATAAATGG - Intergenic
1194533285 X:95076788-95076810 TGGAAGCATGTGTAAATAATAGG + Intergenic
1195628124 X:107025025-107025047 TTGAAGCAGATGTAAATAAATGG - Intergenic
1195794234 X:108626028-108626050 TTAAAGGAAGTTTAAATAAAAGG - Intronic
1196052518 X:111320624-111320646 TTGTACCATATATAAATAAAAGG - Intronic
1196126434 X:112105535-112105557 CTGAAGAAGGTACAAATAAATGG - Intergenic
1196732931 X:118959485-118959507 TTAAAGAAGGTATAAATAAATGG + Intergenic
1197436544 X:126435450-126435472 TTAAAGAATATATAAATAAATGG + Intergenic
1197485399 X:127043758-127043780 TTGAAGAAGATATAAATAAATGG + Intergenic
1198005058 X:132484709-132484731 TTGAAGGGCTTAGAAATAAAGGG - Intronic
1198476853 X:137002942-137002964 TTGAAGCAGGTGGAAAAAAATGG + Intergenic
1198669391 X:139062692-139062714 TTGAAAAAGGTAAAAATAAATGG - Intronic
1200602934 Y:5228712-5228734 TTGAAACCTATATAAATAAATGG - Intronic
1201336229 Y:12883091-12883113 TTAAAGCAGACATAAATAAATGG - Intergenic