ID: 957118395

View in Genome Browser
Species Human (GRCh38)
Location 3:76057178-76057200
Sequence ATCTGATACTAGGCGTATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957118391_957118395 9 Left 957118391 3:76057146-76057168 CCTTCTAAGACCTTTTATTTATA 0: 1
1: 0
2: 4
3: 39
4: 390
Right 957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG 0: 1
1: 0
2: 0
3: 0
4: 30
957118392_957118395 -1 Left 957118392 3:76057156-76057178 CCTTTTATTTATACGTGCTTCAA 0: 1
1: 0
2: 4
3: 33
4: 326
Right 957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957118395 Original CRISPR ATCTGATACTAGGCGTATGC GGG Intronic
921552261 1:216552264-216552286 ATCTAATACTATGCATAAGCAGG + Intronic
1078475417 11:11625020-11625042 ATCAGATAATAGGTGTAAGCAGG + Intergenic
1079927155 11:26508756-26508778 CTCTGATACTAGGATTATGGAGG - Intronic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1106876079 13:34075123-34075145 ATCTGATACTAGAGGTACACTGG + Intergenic
1107018243 13:35726058-35726080 AACTGATACAAGGCTTTTGCAGG + Intergenic
1126484937 15:49169936-49169958 ATCAGAAACTAGGTGTATGTAGG + Intronic
1135923711 16:26673805-26673827 ATCTCATACTTGGAGTAGGCTGG + Intergenic
1139124386 16:64060150-64060172 GCCTGATTCTAGGCCTATGCAGG - Intergenic
1163934373 19:20428865-20428887 CTCTGATACTAGGAGTAAGGTGG + Intergenic
939064392 2:137465172-137465194 GTCTGAAACTAGGAGTAAGCAGG + Intronic
949647591 3:6114658-6114680 ATCTCATATTATGCGTATGTTGG - Intergenic
957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG + Intronic
958095254 3:88935954-88935976 ATCTGAATCTAGGAATATGCAGG - Intergenic
965950070 3:174298229-174298251 ATATAATACTATGTGTATGCAGG - Intergenic
971557065 4:28026088-28026110 ATCTGGTACTGTGCCTATGCTGG - Intergenic
977508703 4:97934977-97934999 ATCTGATACTGGGCGTTTTTTGG + Intronic
985604597 5:851663-851685 ATGTGACACCAGGCGGATGCGGG + Intronic
1000202208 5:159022371-159022393 TTCTGACACTAGGCATATGGAGG + Intronic
1003623258 6:7720918-7720940 ATCTGCTTCTAGGCTTATTCAGG + Intergenic
1007164541 6:39819901-39819923 ATCTGATGCTATGTGTAGGCGGG - Intronic
1007955362 6:45913277-45913299 ATCTGATACTAGGCTGACGAGGG + Intronic
1013727434 6:113116584-113116606 ATCTGATCCTGGGCGTTTTCTGG - Intergenic
1014436936 6:121431212-121431234 ATCTGAGACTAGGCGGGTGTAGG - Intergenic
1014937553 6:127401624-127401646 AACTGAACCTAGGCCTATGCAGG + Intergenic
1017673706 6:156793103-156793125 ATCTGATATTAGGGCTGTGCTGG - Intronic
1024127839 7:46318891-46318913 GTCTCATACTAGGCATATACAGG + Intergenic
1048701415 8:137094634-137094656 ATCTGATACAAGGCTTTTTCTGG - Intergenic
1056110771 9:83392398-83392420 CTTTGGTACTGGGCGTATGCAGG - Intronic
1186939664 X:14491665-14491687 ATGTGATGCTATGGGTATGCAGG + Intergenic
1196098778 X:111827312-111827334 TTTAGATACTATGCGTATGCTGG + Intronic