ID: 957121814

View in Genome Browser
Species Human (GRCh38)
Location 3:76103455-76103477
Sequence AGCTGTGTATTGTGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957121814 Original CRISPR AGCTGTGTATTGTGAGCAGA GGG (reversed) Intronic
900136437 1:1119413-1119435 GGCTGTGAATTAAGAGCAGAAGG + Intergenic
900667349 1:3824551-3824573 TGCTGTGGAGTGGGAGCAGATGG + Intronic
901243448 1:7709197-7709219 AGCTGTTTATGGGGTGCAGAGGG + Intronic
901843018 1:11965518-11965540 AGCTGTCTAGGGAGAGCAGATGG - Exonic
907872434 1:58455214-58455236 AGCTATGACTTGTGAGCAAATGG + Intronic
909319477 1:74265279-74265301 AGCTCTGTATTGGGATCTGATGG - Intronic
912080068 1:105925327-105925349 ACCTGTATATTTTGAGCAGGGGG - Intergenic
912177324 1:107176019-107176041 ACCTGGGTATTTTGAGGAGAAGG + Intronic
913162416 1:116156238-116156260 ATCTGTGTTTGGTGAGTAGAAGG - Intergenic
915635772 1:157185524-157185546 TGCTGTGTGTGGTGAGCAGGTGG - Intergenic
915936369 1:160092408-160092430 AGCTGTGTAGTCTCAGCCGATGG + Exonic
917154439 1:171981259-171981281 AGCAATGTTTTGTGAGCACAGGG - Intronic
918295126 1:183149445-183149467 AGCTGTGTGGTGTGAGGAGAGGG - Intergenic
919610358 1:199738405-199738427 AGCTGTGATTAGTGAGCAGTGGG + Intergenic
920342911 1:205286820-205286842 GGCTGTGTCTTGTGAGAAGGAGG + Intergenic
921649569 1:217660591-217660613 GTCTATGTGTTGTGAGCAGATGG + Intronic
921917914 1:220633490-220633512 TGCTGTGTACTGTGAATAGAAGG + Intronic
922084519 1:222333183-222333205 AGATGTGTATTTTAAGCAAAAGG - Intergenic
922159324 1:223067008-223067030 AGCCGTCTCTTGTGAGCAGCTGG - Intergenic
924142410 1:241039292-241039314 AGGTGTGGGTTGTGAGGAGAGGG + Intronic
924154680 1:241163808-241163830 AGGTGTGGGTTGTGAGGAGAGGG - Intronic
1064000833 10:11662611-11662633 AGCTGTGTGTTGGGGGCAGGAGG - Intergenic
1064136524 10:12755317-12755339 AGCTGCGTTTTGTGGGAAGAGGG + Intronic
1067945808 10:50687263-50687285 TGCTGTGTTCTGTGGGCAGATGG - Intergenic
1068076838 10:52266421-52266443 AGCTGAATAATGTGAGCACATGG - Intronic
1068606310 10:59008769-59008791 AGCTGAGGATTCTGAGAAGAGGG + Intergenic
1070867324 10:79714136-79714158 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1070881116 10:79852260-79852282 TGCTGTGTTCTGTGGGCAGATGG - Intergenic
1071186558 10:83053105-83053127 AACCATGTTTTGTGAGCAGAAGG + Intergenic
1071634239 10:87236359-87236381 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1071647689 10:87368576-87368598 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1072775160 10:98183804-98183826 AGATGTGTAATTTAAGCAGAGGG - Intronic
1073531587 10:104237540-104237562 AGTTGTCTCTTGTGACCAGAGGG + Intronic
1075313596 10:121434286-121434308 AGCTGTGGAGTGTGAGCCGCTGG - Intergenic
1076399242 10:130168763-130168785 AGCTGTGAATTGGGAGAACATGG + Intronic
1076504142 10:130960786-130960808 GGCTGGGTATTGGGGGCAGATGG + Intergenic
1078322344 11:10347855-10347877 AGCTGTGTCTTTTCAACAGAGGG - Intronic
1079750329 11:24188900-24188922 AGCCTTGTTTTGTGTGCAGAGGG + Intergenic
1084270223 11:68025539-68025561 AGCTGTGTGGTGTGAACACAGGG - Intronic
1089387399 11:118077318-118077340 TCCTGTGTCTTGGGAGCAGAGGG - Intronic
1091196505 11:133735797-133735819 ACCAGTGTCATGTGAGCAGAAGG + Intergenic
1092739618 12:11615000-11615022 AGCAGTGTTTTGCGGGCAGAGGG + Intergenic
1096329734 12:50700382-50700404 AGCTCTGTCTTGTGTGAAGAGGG - Intronic
1096731416 12:53616115-53616137 AGCTGGGTTTTGTGAGAAGGTGG + Intronic
1097444147 12:59647600-59647622 AGTTGTGTTTGGTGACCAGAAGG + Intronic
1099579544 12:84426005-84426027 AGCTGTGTATTTTGAAAAGGAGG - Intergenic
1100542941 12:95575087-95575109 AGCTGTCAATTGTGGGTAGAGGG + Intergenic
1100741409 12:97597346-97597368 AGCTGAATATGGTGAGCAGGTGG + Intergenic
1101365223 12:104064523-104064545 AGCGGTGCATTGTGGGCAGAGGG + Exonic
1101736698 12:107468586-107468608 GGCTGCGGATTGTGAGCTGAGGG + Intronic
1102161080 12:110769510-110769532 AGGTGTATTTTGAGAGCAGATGG - Intergenic
1106124528 13:26889491-26889513 AGCTGTCTTTTGGGTGCAGAGGG + Intergenic
1106475140 13:30091952-30091974 GGCTGCTTAATGTGAGCAGAAGG - Intergenic
1107036061 13:35904070-35904092 AGCTGTGTGTTATGTGCAGAGGG + Intronic
1110147763 13:72213333-72213355 AGCCGTGTATTATGAGAAGTTGG + Intergenic
1111489129 13:88946453-88946475 AGCTTTGTATTGTCAGGGGAAGG - Intergenic
1113180625 13:107621384-107621406 AGCTGTGAACTGTGAGAAGATGG + Intronic
1115826607 14:37285328-37285350 AGAAGTGTATTTTGCGCAGAAGG + Exonic
1118284159 14:64455901-64455923 AGCTCTCTATAGAGAGCAGAAGG + Intronic
1119686110 14:76632661-76632683 AGCTTTGTTTTCTGAGGAGAGGG + Intergenic
1122797368 14:104212731-104212753 AGCTGTGTGTTGTGAGAGGTAGG + Intergenic
1126127327 15:45307588-45307610 AGTTGTCTATTGTGAACAGAAGG + Intergenic
1126362646 15:47862148-47862170 ACCTGTGACTTGTGAGAAGAAGG - Intergenic
1127356472 15:58205455-58205477 AGATGGTTACTGTGAGCAGATGG + Intronic
1128134103 15:65249944-65249966 TGCTCTGTTTTATGAGCAGAAGG - Intronic
1130709116 15:86262037-86262059 AGCAGTGAATTATTAGCAGAAGG - Intronic
1133646558 16:7770006-7770028 TGCTGTGTACTTTGAGCTGAAGG - Intergenic
1134161188 16:11890914-11890936 TACTGTGTATTATGAGGAGAGGG + Intronic
1134778487 16:16873539-16873561 AGCTATGTTTTGGGAGCTGAGGG - Intergenic
1135097045 16:19573231-19573253 AGCTGTCTATTGTGAGTACCAGG + Exonic
1138157087 16:54715861-54715883 AGATTTGTCTTGGGAGCAGATGG - Intergenic
1139009591 16:62616030-62616052 AGCTGTTTAATGTGTGTAGAAGG - Intergenic
1139162904 16:64533175-64533197 AGATGTGAATTTTGAACAGACGG - Intergenic
1140915286 16:79487931-79487953 ACCTGAGCATTGTGAGCACAGGG - Intergenic
1142751870 17:1993840-1993862 AGCTGTGTGTTGTGAATACAGGG - Intronic
1143022258 17:3922962-3922984 CCCTGGGTATTGTGAGCTGAGGG + Intergenic
1144116014 17:12091363-12091385 TGCTGTGTTTTGTGACGAGATGG + Intronic
1144293773 17:13853937-13853959 CGCTGTGTCCTGTGAGCAGTGGG + Intergenic
1148806141 17:50264909-50264931 AGCCTTGGATTGTGAACAGAGGG + Intergenic
1149509443 17:57226883-57226905 AGATTGGTATTGTGGGCAGAAGG + Intergenic
1150578609 17:66452449-66452471 AGCTGTGTATAGCGAGAATAAGG + Intronic
1151529084 17:74692862-74692884 AGCAGTGTATTTGGAGTAGAAGG - Intronic
1153530859 18:6044319-6044341 AGATGTGTATTTTCATCAGAGGG - Intronic
1156253352 18:35373392-35373414 AGATGTGTGTGGTGAGCAGAGGG + Intronic
1156715504 18:40004166-40004188 AGAAGTGTATTTGGAGCAGATGG - Intergenic
1158686703 18:59621258-59621280 AGCTGTGTTTCATCAGCAGATGG + Intronic
1159289968 18:66404379-66404401 AGCTGTGAACTGTCAGCAGTGGG + Intergenic
1160018369 18:75161628-75161650 AGCTGATTATTCTGAGAAGAAGG + Intergenic
1161089958 19:2354771-2354793 AGCTGTGTTTAATGATCAGACGG - Intronic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1162957351 19:14106880-14106902 GGCTGTGTTCTGTGGGCAGAGGG + Exonic
925800531 2:7595043-7595065 AGCTTTGCATTGTCAGCCGAAGG + Intergenic
927275037 2:21255291-21255313 AACTGTGTGCTGTCAGCAGAGGG + Intergenic
927341707 2:21990821-21990843 AGTTGGGTATTGTGAGTACATGG - Intergenic
928388463 2:30889518-30889540 AGATGTGGATTGTAAGCAGTGGG - Intergenic
931157824 2:59655354-59655376 CGGTGAGTATTGAGAGCAGAGGG - Intergenic
932306624 2:70708174-70708196 ATCTGTGTATTCTGGGCTGATGG - Intronic
933680377 2:85094713-85094735 AGCTCTGTATTGTGTGGAGGAGG + Intergenic
936057621 2:109272699-109272721 GGCTGTGTGTGGTCAGCAGAGGG + Intronic
936060580 2:109293265-109293287 TGCTGGGTATTTTTAGCAGAAGG - Intronic
936074020 2:109390331-109390353 AGGGGTGTCCTGTGAGCAGAAGG - Intronic
938191561 2:129286518-129286540 AGTTGAGTATTGAGAGCACATGG - Intergenic
938766527 2:134463655-134463677 ACCTGTGTATTTATAGCAGAGGG + Intronic
938777361 2:134553742-134553764 AGCTGTGCATGGTGACCAGCTGG + Intronic
939415977 2:141897721-141897743 AACTGAGTATTTTGAGCAGATGG - Intronic
940438848 2:153689800-153689822 AGATGTGTGTTGTGAGGAGCGGG + Intergenic
946052107 2:216871718-216871740 AGATGGGTGTTGTAAGCAGAGGG + Intergenic
947360900 2:229344373-229344395 AGCTCTGTCTTCTGAGCACATGG + Intergenic
948934831 2:241156717-241156739 GGCTGTATATTGTGACTAGATGG - Intronic
1169410118 20:5361653-5361675 AGCTGTGTGTTTTGGGCAAACGG + Intergenic
1169464566 20:5826174-5826196 AGCTGTTTATTGTTTGCAGATGG + Intronic
1169976150 20:11330500-11330522 ATCTTTGTACTGTGACCAGAGGG + Intergenic
1172432533 20:34904545-34904567 ATCTGAGCATTCTGAGCAGAAGG + Intronic
1174659521 20:52199383-52199405 ATCTGTATATTGTTAGGAGAAGG - Intronic
1177374100 21:20246035-20246057 AGCTGAGTATTGGGATCAAAAGG + Intergenic
1178407614 21:32337368-32337390 GGCTGGGTAGTGTGAGCAGGGGG - Intronic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1179080662 21:38167678-38167700 AGCTGTCTTCTGGGAGCAGAAGG - Intronic
1179110250 21:38439950-38439972 AGCTGGGTATTCTAGGCAGAAGG + Intronic
1183247724 22:36706652-36706674 AGCCTTGCATGGTGAGCAGAAGG - Intergenic
1183745697 22:39690438-39690460 GGCTGTGTTTTGGAAGCAGAAGG + Intergenic
1184553774 22:45220893-45220915 AGCAGTGTTTTGTGAGAAGTGGG - Intronic
1185063198 22:48617778-48617800 GGCTGTGTGTTCTGAGAAGACGG + Intronic
1185326320 22:50227532-50227554 AGCTGGGCATTGGGAGCAGTGGG - Intronic
1185338807 22:50282665-50282687 AGCTGGGTGTGGGGAGCAGAGGG + Intronic
950353127 3:12376739-12376761 AGCTGTGAAGTTTCAGCAGAAGG - Intronic
952114390 3:30161681-30161703 AGCTGCGTTTTGTGAACACATGG - Intergenic
953847052 3:46436056-46436078 AGCAGGGAATTGTAAGCAGATGG + Exonic
956452002 3:69384538-69384560 AGCTATGTAATGTGGCCAGATGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957121814 3:76103455-76103477 AGCTGTGTATTGTGAGCAGAGGG - Intronic
957166763 3:76684094-76684116 AGGTATGTATTGTTAGGAGAAGG + Intronic
957293161 3:78303688-78303710 AAATGTATATTTTGAGCAGATGG + Intergenic
960173520 3:114490867-114490889 AACTGGGTATTGTGAGGACAGGG + Intronic
965895387 3:173569748-173569770 AGCTGTGAATTGGGAGCTGCTGG + Intronic
967441265 3:189511582-189511604 ATCTGTGAAATGAGAGCAGATGG - Intergenic
968898989 4:3421995-3422017 AGCTGTGTATAGAGAGGACAGGG + Intronic
969943921 4:10763301-10763323 GGCTGTGAGTAGTGAGCAGAAGG + Intergenic
971210968 4:24615896-24615918 AGTTGTGTATAGTGTGCAGTAGG + Intergenic
971298626 4:25423890-25423912 AGTGGGGTATTGAGAGCAGAAGG + Intergenic
971341488 4:25773564-25773586 AGCTGTGTATGGTGAATAGAAGG - Intronic
971373765 4:26039588-26039610 AGGTGTGTCCTGTGAACAGATGG - Intergenic
971419551 4:26463025-26463047 AGATGATTAATGTGAGCAGAAGG - Intergenic
971855810 4:32042172-32042194 GGCTGTGTATTGGGAGAAGAGGG - Intergenic
972216898 4:36907467-36907489 CACTGTGTGTTGGGAGCAGAGGG - Intergenic
973153478 4:46916998-46917020 ACATGTGTATGCTGAGCAGAGGG - Intergenic
975759038 4:77599763-77599785 AGCTTTGTGTTTTGAGAAGATGG + Intronic
976226766 4:82800337-82800359 TGCTGGGTATGGGGAGCAGAGGG - Intergenic
976449274 4:85167789-85167811 TGCTGTGTGTTTGGAGCAGAGGG + Intergenic
977808139 4:101327095-101327117 AGCTGTATATTGTGACCACATGG - Intronic
978337830 4:107688681-107688703 AACTGTGTAAGGTGAGCAGTGGG - Intronic
978408197 4:108401149-108401171 TGCTGTGTACCGTGAGCACATGG - Intergenic
980588268 4:134849160-134849182 AGCTGAGTGGTGGGAGCAGATGG + Intergenic
985103489 4:186480298-186480320 TGCTGAGTGTTTTGAGCAGAAGG + Intronic
985877563 5:2611844-2611866 ATCTGTGTCTTGTGATCATAGGG - Intergenic
986277294 5:6287773-6287795 AGATGGGTAATGTAAGCAGAGGG + Intergenic
986346218 5:6837703-6837725 TGCTGAGTTTTGTCAGCAGAGGG - Intergenic
988027573 5:25717609-25717631 TGCTATATATTGTGAGCATAGGG - Intergenic
989285556 5:39695160-39695182 ATCTTTGTCATGTGAGCAGAAGG - Intergenic
989791916 5:45414746-45414768 ACCTGTGTATTGTAAAGAGATGG - Intronic
993194637 5:84725110-84725132 AGCTGTGTATTGGAACCACAGGG - Intergenic
994017062 5:94979391-94979413 AGCTGTATACGGTGATCAGATGG + Intronic
994766875 5:103929465-103929487 AGCTTTGTTTAGTGAGCACATGG + Intergenic
995100578 5:108297561-108297583 AACTGTTTATTCTGTGCAGAGGG + Intronic
995576967 5:113547171-113547193 CTGTGTGTATTTTGAGCAGAAGG - Intronic
996751154 5:126890134-126890156 CGCTGTGTTATCTGAGCAGAGGG + Intronic
999721575 5:154402541-154402563 AACTGTGTATTGTGTTAAGATGG - Intronic
1001219236 5:169884896-169884918 AGCTGAGTATTTTGAGTGGAGGG + Intronic
1001536707 5:172503170-172503192 AGCAATGCAGTGTGAGCAGAGGG + Intergenic
1003963049 6:11227168-11227190 GGATGTGTATTGTAAGCATAGGG - Intronic
1009741401 6:67751436-67751458 TGTTGTGTATGGTGGGCAGAGGG + Intergenic
1009937480 6:70250847-70250869 AACTGTGTATAGTGAGAAAATGG + Intronic
1010150518 6:72726535-72726557 AGCTGTTTGTTGTGAGAATATGG - Intronic
1010308783 6:74357803-74357825 AGCTGTGTTCTGGGTGCAGAAGG - Intergenic
1011293675 6:85804858-85804880 AGCTGTGGCCTGAGAGCAGATGG - Intergenic
1011740178 6:90351557-90351579 AGCTGTGTTTTATTATCAGAGGG - Intergenic
1015957375 6:138612991-138613013 AGCTCTGTATTGAGAGCTAATGG + Intronic
1019342346 7:514483-514505 AGCTGTGTTTGGTGAGCTGTGGG - Intronic
1020557986 7:9693426-9693448 AGCTGTGTCTTTTGAGCTGAGGG - Intergenic
1021910595 7:25382501-25382523 AGCTGTGTATTGGGAGAGGGTGG - Intergenic
1022280657 7:28905725-28905747 AGATGTGTATTCTCTGCAGATGG + Intergenic
1024874137 7:54002202-54002224 AGCAGTGTATTGAGAACTGAAGG - Intergenic
1025745545 7:64239495-64239517 ATCTGTGTGTTGAGACCAGAAGG - Intronic
1029216979 7:98957590-98957612 AGGGGTGCATTGAGAGCAGAGGG - Intronic
1033566996 7:142588402-142588424 AGCTGTGAGTTGAGAGGAGAAGG - Intergenic
1034357346 7:150462025-150462047 AGCAGTGTTTTGTGGGCAGGGGG + Intronic
1034401627 7:150865235-150865257 AGGTGGGTAGTGGGAGCAGACGG - Intergenic
1035307332 7:157941875-157941897 CGCTGTGTCCTGTGAGGAGATGG - Intronic
1037058587 8:14477871-14477893 AACTGTATATTGAGAGCTGAAGG - Intronic
1037203310 8:16284309-16284331 AGTTGTGTCAGGTGAGCAGAGGG - Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1038940339 8:32297388-32297410 TGCAGTTTATTCTGAGCAGAGGG + Intronic
1038965077 8:32562719-32562741 AGCTGTCTCTTGGGAGGAGAGGG + Intronic
1040691923 8:49949068-49949090 AGGTGTGTAGTGTGAGAACAAGG - Intronic
1041301083 8:56412022-56412044 AGCTGAGTAATGAGAGCACATGG - Intergenic
1042113022 8:65401697-65401719 AACTGTGGATTTTGAGCAGCTGG - Intergenic
1047567842 8:126065237-126065259 ACCTCTGTTTTGTGAGCACATGG - Intergenic
1047680136 8:127246201-127246223 AGATGTGAAATGTGAGCAAAAGG + Intergenic
1052597643 9:30580776-30580798 AAATTTATATTGTGAGCAGAGGG - Intergenic
1052889252 9:33682435-33682457 AGCTGGGGTTTATGAGCAGAGGG - Intergenic
1053074456 9:35121002-35121024 AGCAATGTTTTGTGGGCAGAGGG - Intergenic
1055775275 9:79761046-79761068 TGCTGGGTATTTTTAGCAGAAGG + Intergenic
1056127001 9:83544105-83544127 AGCTGTCTATTTTGGGCTGAGGG + Intergenic
1056851202 9:90086036-90086058 ATCTGTGTTTTATGAGCAAATGG + Intergenic
1057353134 9:94316801-94316823 TGCTGTGTTCTGTGGGCAGATGG + Intergenic
1057654613 9:96940790-96940812 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1057923163 9:99116362-99116384 AGCTGTGCATTGCAAACAGATGG + Intronic
1058754596 9:108072728-108072750 ATCTGTTGATTGTCAGCAGACGG - Intergenic
1058878400 9:109265066-109265088 AGCTGGGGATTGGGAGCAGCTGG - Intronic
1059179734 9:112200513-112200535 AGCAGTGTGGTGTGATCAGAAGG + Intergenic
1060094784 9:120778502-120778524 AGCTGTGGGATGTGAGCACAGGG - Exonic
1062539926 9:137037065-137037087 AGGTGTGTATTGTGACCTGAGGG + Exonic
1186111711 X:6264833-6264855 AGCTGTGCATTGTAATCAGTGGG + Intergenic
1186410770 X:9342797-9342819 AGCCGTGTTTTGGGAGCACAGGG - Intergenic
1187668544 X:21644231-21644253 AGCTGTGTAATGAGCCCAGAAGG - Intronic
1188465146 X:30471319-30471341 ATCAGTGGAATGTGAGCAGAAGG - Intergenic
1189176021 X:38958019-38958041 AGCAGTTTAATGTGAGCACATGG + Intergenic
1191971079 X:66817000-66817022 AGTTGAGTCTTGTGAACAGAAGG + Intergenic
1193700388 X:84753350-84753372 AACTGTTTATTGATAGCAGATGG - Intergenic
1194057461 X:89153413-89153435 AACTGTATATTGTTATCAGATGG + Intergenic
1195540530 X:106057616-106057638 AGCTATGTATTGTGGAAAGAGGG + Intergenic
1198545433 X:137687110-137687132 TGCTGAGTATTTTGAGCTGAAGG - Intergenic
1198984325 X:142431861-142431883 AGGTGTGTATGGGGAGCATATGG - Intergenic
1200064381 X:153497551-153497573 AGCTGTGGGGTGTGTGCAGAGGG + Intronic