ID: 957123962

View in Genome Browser
Species Human (GRCh38)
Location 3:76133816-76133838
Sequence GGCGGTGCCCACCCAGATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1527
Summary {0: 1, 1: 0, 2: 31, 3: 426, 4: 1069}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957123958_957123962 22 Left 957123958 3:76133771-76133793 CCTTCTTCTATCTGCTTTTATTC 0: 1
1: 2
2: 15
3: 75
4: 779
Right 957123962 3:76133816-76133838 GGCGGTGCCCACCCAGATCGAGG 0: 1
1: 0
2: 31
3: 426
4: 1069
957123957_957123962 25 Left 957123957 3:76133768-76133790 CCACCTTCTTCTATCTGCTTTTA 0: 1
1: 1
2: 32
3: 300
4: 1215
Right 957123962 3:76133816-76133838 GGCGGTGCCCACCCAGATCGAGG 0: 1
1: 0
2: 31
3: 426
4: 1069
957123956_957123962 29 Left 957123956 3:76133764-76133786 CCTTCCACCTTCTTCTATCTGCT 0: 1
1: 2
2: 43
3: 168
4: 861
Right 957123962 3:76133816-76133838 GGCGGTGCCCACCCAGATCGAGG 0: 1
1: 0
2: 31
3: 426
4: 1069

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957123962 Original CRISPR GGCGGTGCCCACCCAGATCG AGG Intronic