ID: 957123962 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:76133816-76133838 |
Sequence | GGCGGTGCCCACCCAGATCG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1527 | |||
Summary | {0: 1, 1: 0, 2: 31, 3: 426, 4: 1069} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
957123958_957123962 | 22 | Left | 957123958 | 3:76133771-76133793 | CCTTCTTCTATCTGCTTTTATTC | 0: 1 1: 2 2: 15 3: 75 4: 779 |
||
Right | 957123962 | 3:76133816-76133838 | GGCGGTGCCCACCCAGATCGAGG | 0: 1 1: 0 2: 31 3: 426 4: 1069 |
||||
957123957_957123962 | 25 | Left | 957123957 | 3:76133768-76133790 | CCACCTTCTTCTATCTGCTTTTA | 0: 1 1: 1 2: 32 3: 300 4: 1215 |
||
Right | 957123962 | 3:76133816-76133838 | GGCGGTGCCCACCCAGATCGAGG | 0: 1 1: 0 2: 31 3: 426 4: 1069 |
||||
957123956_957123962 | 29 | Left | 957123956 | 3:76133764-76133786 | CCTTCCACCTTCTTCTATCTGCT | 0: 1 1: 2 2: 43 3: 168 4: 861 |
||
Right | 957123962 | 3:76133816-76133838 | GGCGGTGCCCACCCAGATCGAGG | 0: 1 1: 0 2: 31 3: 426 4: 1069 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
957123962 | Original CRISPR | GGCGGTGCCCACCCAGATCG AGG | Intronic | ||