ID: 957127226

View in Genome Browser
Species Human (GRCh38)
Location 3:76177543-76177565
Sequence ATCCTGCTGGGTCATCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957127226 Original CRISPR ATCCTGCTGGGTCATCTGGT GGG Intronic
900962485 1:5934195-5934217 ATCCTGCAGGCTCCCCTGGTGGG + Intronic
903015242 1:20357464-20357486 CTGCTGCTGGGTCACCTGCTCGG - Intergenic
904202603 1:28831014-28831036 GTCCTGCAGGGGCATCTGGTGGG - Intronic
904584273 1:31570877-31570899 ATCATCCTGGGTTATCTGGGTGG - Intergenic
904787545 1:32994025-32994047 ACCCTGCTGGGTTATCTGACAGG + Intergenic
907580571 1:55568577-55568599 ATCATGCTGGATGATCTGGAGGG + Intergenic
908529532 1:65021143-65021165 ATTCTGCTGGGTTCTCTGGGTGG - Intergenic
908591603 1:65642831-65642853 ATACTGCTGGGTCATAGGTTAGG + Intergenic
911129666 1:94375647-94375669 CTTTTGCTGGATCATCTGGTTGG + Intergenic
912261831 1:108118490-108118512 ATCCTGCAGGGTGATCTGATGGG + Intergenic
915340015 1:155172235-155172257 GTCCTGCTGCTTCTTCTGGTGGG + Intronic
916097749 1:161366035-161366057 ATCCTGCTGGGTAAGCTGGCCGG + Exonic
916809405 1:168292310-168292332 CTCCTGCTGTGAAATCTGGTAGG - Intronic
919291394 1:195637653-195637675 ATCCTGCATGCTCCTCTGGTAGG - Intergenic
922654191 1:227366450-227366472 ATCCTTTTGGGTCACCTGCTTGG + Intergenic
1063113538 10:3056888-3056910 ATCCCACTGGATCATCAGGTGGG - Intergenic
1063426336 10:5952960-5952982 ATCCTGCTGGGACTTCTGAGAGG + Exonic
1065082528 10:22141968-22141990 ATATTGTTGGATCATCTGGTTGG - Intergenic
1067392982 10:45882845-45882867 ATCATTGTGGGACATCTGGTTGG - Intergenic
1067710491 10:48647677-48647699 CTCTTGCTGGGTCGTATGGTAGG - Intronic
1067861305 10:49851973-49851995 ATCATTGTGGGACATCTGGTTGG - Intronic
1068142684 10:53027142-53027164 ATGTTGCTGAATCATCTGGTTGG + Intergenic
1068938574 10:62658772-62658794 AGCCTGCTGGGTCAAGTGGGTGG + Intronic
1070458908 10:76645152-76645174 ATGCTTATGTGTCATCTGGTAGG - Intergenic
1071228124 10:83555496-83555518 GGACTGCTGGGTCATATGGTAGG + Intergenic
1072852014 10:98905918-98905940 ATCCTGAAGGGAGATCTGGTGGG - Intronic
1073890486 10:108096053-108096075 AGCCTGCTGGGCCAACTGGGTGG - Intergenic
1077958833 11:7051135-7051157 ATCTTTCTGGGTCAACTAGTAGG + Intronic
1078491386 11:11772389-11772411 CTTGTGCTGGGTCTTCTGGTAGG - Intergenic
1078501228 11:11879576-11879598 CTCCTCCTGGCTCATCTGTTTGG + Intronic
1078528402 11:12118105-12118127 GACCTTCTAGGTCATCTGGTTGG - Intronic
1079601270 11:22315374-22315396 TTGCTGCTGGATCATCTGGTTGG + Intergenic
1080353356 11:31411718-31411740 ATTTTGCTGGATTATCTGGTTGG - Intronic
1080871995 11:36244497-36244519 ATTATTCTGGGTCATCTGGATGG - Intergenic
1083762328 11:64825471-64825493 ATCCTGGTGGGTCACCTGGAGGG + Intronic
1084258670 11:67959641-67959663 ATCCTTGTTTGTCATCTGGTTGG + Intergenic
1085257615 11:75184865-75184887 ATTCTGCTGGGTGTTGTGGTGGG - Intronic
1087458882 11:98421838-98421860 CTGTTGTTGGGTCATCTGGTTGG + Intergenic
1087904689 11:103682022-103682044 TGCCTGCTGGAGCATCTGGTGGG - Intergenic
1091573797 12:1714011-1714033 GTCCTGTTGGATCATCTGGTTGG + Intronic
1091854175 12:3725497-3725519 ATCATCCTGGGTTATCTGGGTGG - Intronic
1095881509 12:47141886-47141908 CTCCTCCTGGGTCCTTTGGTGGG - Intronic
1096148679 12:49295619-49295641 CTCCTGCTGGCACAGCTGGTCGG - Exonic
1097009927 12:55945751-55945773 ATCATACTGGATCATCTGGGTGG - Intronic
1099576748 12:84392471-84392493 CTGTTGTTGGGTCATCTGGTTGG + Intergenic
1100805405 12:98277995-98278017 ATCATCCTGGATTATCTGGTTGG - Intergenic
1101064343 12:101003977-101003999 ATCCTGCTTGGTAATCTGATAGG - Intronic
1102560497 12:113758695-113758717 ACCATGCTGGGCTATCTGGTGGG + Intergenic
1102991699 12:117320803-117320825 CTCCTGCTGTGTCTTCTGCTAGG + Intronic
1103403864 12:120661128-120661150 AAGCTCCTGGGTCATCAGGTGGG + Exonic
1103799407 12:123527703-123527725 ATCTGGCTGGATTATCTGGTGGG + Intronic
1105436194 13:20380451-20380473 ATCCTCCTGGGTTACCTGGTGGG + Intergenic
1105543882 13:21337920-21337942 AACCTTCCAGGTCATCTGGTTGG + Intergenic
1107198431 13:37683222-37683244 CCCCTGCTGGGGCATCTGTTTGG + Intronic
1107623353 13:42257254-42257276 GGACTGCTGGGTCATATGGTAGG + Intergenic
1111182457 13:84686933-84686955 ATCTTGCTGAGTGATTTGGTTGG - Intergenic
1112653463 13:101423437-101423459 TTCCTGCTGGGCGATCTGGGAGG - Intergenic
1117204112 14:53423746-53423768 GTTTTGCTGGGTCATATGGTTGG + Intergenic
1117246915 14:53895647-53895669 CTCCCGCTGGGACCTCTGGTAGG + Intergenic
1119129883 14:72162336-72162358 TCCCTGCTGGGCCATCTGGAAGG + Intronic
1121235185 14:92386961-92386983 ACCCTGCTGGGGCCTCTGGAAGG - Intronic
1122705816 14:103620595-103620617 AAATTGCTGGGTCATCAGGTAGG - Intronic
1123894796 15:24817898-24817920 ATCTTGCTGTGTCATCAGGCTGG - Intergenic
1124007048 15:25802788-25802810 ATTCTCCTGGATCATCTGGGTGG - Intronic
1126086286 15:45013730-45013752 GTCCTGTTGGGTCATCTCGCTGG - Intergenic
1128168046 15:65484917-65484939 ATCCTGCTGGTTCATAAGATGGG - Intronic
1132796669 16:1727836-1727858 ATCCTGCTCTGTGATCTGGGGGG - Intronic
1133257902 16:4529277-4529299 CTCCTGCTGGGTCTCCTGGCGGG - Intronic
1138140289 16:54562450-54562472 ACCTTGCTGGCTCCTCTGGTGGG - Intergenic
1139695253 16:68669694-68669716 CTCCTTCTGGGTTACCTGGTGGG + Intronic
1140733939 16:77881121-77881143 AGACTGCTGGGTCAAATGGTAGG + Intronic
1141095698 16:81161333-81161355 ATTATCCTGGGTTATCTGGTGGG - Intergenic
1141162397 16:81638206-81638228 ATCACGCTGGATTATCTGGTGGG - Intronic
1141449543 16:84088796-84088818 TTTCTGCTTGGGCATCTGGTGGG - Intronic
1151047046 17:70933071-70933093 ATGCTTCTGGATCATCTGGAGGG + Intergenic
1151442112 17:74136143-74136165 ATCTTCCTGGGTCACCTGCTGGG - Intergenic
1151462370 17:74262089-74262111 CTCCGGCAGGGTCATGTGGTGGG + Intergenic
1152634432 17:81424802-81424824 ATAGTGCTGGGTGATATGGTTGG + Intronic
1153122477 18:1746153-1746175 ATCTTGCTGGGCCAGTTGGTGGG - Intergenic
1154395627 18:13985698-13985720 ATGGTGCTGGGACAACTGGTTGG + Intergenic
1155567461 18:27151574-27151596 ATCATTCTGGATCATCTGGGTGG + Intronic
1158110056 18:53930929-53930951 ATTATCCTGGGTTATCTGGTTGG - Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1163661484 19:18580597-18580619 CTGTTGCTGGATCATCTGGTTGG - Intronic
1165359105 19:35323366-35323388 CAATTGCTGGGTCATCTGGTAGG + Intronic
926349480 2:11982233-11982255 AGCCTGATGGGGCATCTGGGTGG + Intergenic
926614386 2:14981152-14981174 ATTGTGCTGGGTCACTTGGTGGG - Intergenic
930124443 2:47784221-47784243 ATCCGGCTGGGTCCTTCGGTAGG + Intronic
930963986 2:57297278-57297300 ATGCTGGTGGATCATCTGGCTGG - Intergenic
931059944 2:58516375-58516397 ATCATGGAGGGTCATATGGTGGG - Intergenic
931335710 2:61341321-61341343 AAACTGCTGGGTCATATGGTAGG + Intronic
932054572 2:68431740-68431762 AGCCTGCTGGGCCAACTGGGTGG - Intergenic
932361329 2:71109385-71109407 AACCTGGTGCGTCATCTAGTAGG - Intergenic
932420317 2:71597578-71597600 ATGCTGCAGGATCATCTGGAAGG - Intronic
934124619 2:88875622-88875644 GGACTGCTGAGTCATCTGGTAGG - Intergenic
942113964 2:172709392-172709414 ATATTGATGGGTCATTTGGTAGG - Intergenic
942146580 2:173032884-173032906 AGACTCCTGGGTCATCTGGGAGG - Intronic
942837002 2:180312519-180312541 ATGCTGCTGTATCCTCTGGTTGG - Intergenic
944646838 2:201788559-201788581 ATCCTGCTGGGTTCTCTGAAGGG + Intergenic
945648065 2:212525794-212525816 ATTCTGTTGGCTCATCTGGCAGG + Intronic
948510542 2:238461347-238461369 ATCATCCTGGATGATCTGGTTGG - Intergenic
1169218326 20:3806057-3806079 GCCCTGCTGAGTCATCTGTTAGG + Exonic
1170499894 20:16963937-16963959 ATCTTGCTGGATCTTCTGTTTGG - Intergenic
1172340753 20:34155579-34155601 CTGTTGCTGGATCATCTGGTTGG - Intergenic
1176524790 21:7857925-7857947 AGCCTGCTGGGCCAACTGGATGG - Intergenic
1176719847 21:10384168-10384190 ATCATGCTGGAGCCTCTGGTGGG - Intergenic
1176719852 21:10384194-10384216 ATCATGCTGGAGCCTCTGGTGGG - Intergenic
1176719857 21:10384220-10384242 ATCATGCTGGAGCCTCTGGTGGG - Intergenic
1176719873 21:10384324-10384346 ATCATGCTGGAGCTTCTGGTGGG - Intergenic
1176719878 21:10384350-10384372 ATCATGCTGGAACCTCTGGTGGG - Intergenic
1176719943 21:10384689-10384711 ATCATGCTGGAGCTTCTGGTGGG - Intergenic
1176719948 21:10384715-10384737 ATCATGCTGGAGCTTCTGGTGGG - Intergenic
1176719957 21:10384767-10384789 ATCATGCTGGAGCTTCTGGTGGG - Intergenic
1176719984 21:10384975-10384997 ATCATGCTGGAGCTTCTGGTGGG - Intergenic
1176720012 21:10385106-10385128 ACCATGCTGGGGCTTCTGGTGGG - Intergenic
1176720031 21:10385184-10385206 ACCATGCTGGGGCTTCTGGTGGG - Intergenic
1176720038 21:10385210-10385232 ATCATGCTGGAGCTTCTGGTAGG - Intergenic
1178384312 21:32137082-32137104 ATCATCCTGGGTTATCTGGGTGG + Intergenic
1178658810 21:34487938-34487960 AGCCTGCTGGGCCAACTGGATGG - Intergenic
1179031875 21:37727660-37727682 ATGCTGCTGAGACCTCTGGTAGG + Intronic
1180301082 22:11037129-11037151 ATCATGCTGGAGCCTCTGGTGGG - Intergenic
1180301087 22:11037155-11037177 ATCATGCTGGAGCCTCTGGTGGG - Intergenic
1180301092 22:11037181-11037203 ATCATGCTGGAGCCTCTGGTGGG - Intergenic
1180301108 22:11037285-11037307 ATCATGCTGGAGCTTCTGGTGGG - Intergenic
1180301113 22:11037311-11037333 ATCATGCTGGAACCTCTGGTGGG - Intergenic
1180301153 22:11037546-11037568 ATCATGCTGGAGCTTCTGGTGGG - Intergenic
1180301177 22:11037676-11037698 ATCATGCTGGAGCTTCTGGTGGG - Intergenic
1180301191 22:11037780-11037802 ATCATGCTGGAGCTTCTGGTGGG - Intergenic
1180301238 22:11038014-11038036 ACCATGCTGGGGCTTCTGGTGGG - Intergenic
1180895064 22:19325096-19325118 ATGATGCTGGGACATCTGGATGG + Intergenic
1181345720 22:22219405-22219427 AAGCTGCTGGGACAGCTGGTAGG - Intergenic
1181681042 22:24495849-24495871 CACCTGCTGGGTGCTCTGGTTGG - Intronic
1182712067 22:32329457-32329479 ATCTTGCTGGGCCATCTAGATGG + Intergenic
1182996000 22:34812979-34813001 ATCCTGGTGGGGCATGGGGTGGG - Intergenic
1183080339 22:35451960-35451982 ATCCTGCAGGGTGATGGGGTGGG + Intergenic
1184047261 22:41979190-41979212 ATGCTGCTTGGGGATCTGGTAGG + Intronic
1184458344 22:44623979-44624001 CACCTGCTGGGCCATCTGGGGGG + Intergenic
950149605 3:10676442-10676464 ATCATCCTGGCTCATCTGTTGGG + Intronic
955093506 3:55774656-55774678 TACCTGGTGGGTAATCTGGTGGG - Intronic
957127226 3:76177543-76177565 ATCCTGCTGGGTCATCTGGTGGG + Intronic
958844276 3:99246747-99246769 TTCCTGCTGGGACCTCTGATGGG - Intergenic
959926909 3:111932327-111932349 GTCCAGCTGGGTCTTCTGCTCGG - Exonic
960636777 3:119792373-119792395 ATCCTGCTGAGCCACCTGTTTGG - Intronic
964773920 3:160254959-160254981 ATCTTGCTCTGTCATCAGGTTGG + Intronic
967588774 3:191246933-191246955 ATTATCCTGGGTTATCTGGTTGG - Intronic
970705525 4:18797183-18797205 AGCCTGCTTGTTAATCTGGTAGG - Intergenic
970768625 4:19582876-19582898 ATCATCCTGGATTATCTGGTTGG + Intergenic
971803319 4:31320670-31320692 ATTATTCTGGATCATCTGGTGGG + Intergenic
973669719 4:53203851-53203873 CTCCTGCTGAGTGATCTGGATGG - Intronic
974080611 4:57208597-57208619 ATTCTCCTGGGTTATCTGGGTGG + Intergenic
974950288 4:68578113-68578135 ATCCTGGTGGGGCTCCTGGTTGG - Intronic
985500884 5:244248-244270 CTCCTGCTGGGACCTTTGGTGGG - Intronic
985553600 5:545526-545548 GTCCCGGTAGGTCATCTGGTTGG - Intergenic
985735977 5:1583276-1583298 CTCCTGCTGGGACCTTTGGTGGG + Intergenic
988644582 5:33080304-33080326 ATCTTTCTGGGTTTTCTGGTGGG + Intergenic
990195587 5:53311387-53311409 TTCCTGCAGGTTCATCTGGTTGG - Intergenic
992049456 5:72929470-72929492 CTGTTGCTGGATCATCTGGTTGG - Intergenic
992455286 5:76910659-76910681 CTGTTGCTGGATCATCTGGTTGG - Intronic
992690723 5:79237471-79237493 TTCCTGCTCGGTCATCTCGGGGG - Exonic
993851522 5:93015877-93015899 GTACTGCTGGGTCTTCTGCTGGG - Intergenic
994016108 5:94967239-94967261 ATCCTGCTGGGTGGTCTGCTGGG + Intronic
995465175 5:112444121-112444143 ACCCTGCTGGATCCTCTGGATGG - Intergenic
997702112 5:135909774-135909796 CTCCTGCTGGGTCCTGTGCTTGG - Intergenic
997904330 5:137800123-137800145 ATCCTGCTGGGTCACTGGCTGGG - Intergenic
997955504 5:138275586-138275608 ATCCTGCTGTGGCCTCTGGGGGG + Intergenic
999509347 5:152232036-152232058 TTCCTGCTGAGTCATGAGGTAGG + Intergenic
999717061 5:154369811-154369833 ATGCTGCTGACTCATCTGGTTGG + Intronic
999743244 5:154573027-154573049 ATGCTGGTGGGTCATCTTTTGGG - Intergenic
999977984 5:156930954-156930976 ATTATCCTGGGTTATCTGGTGGG + Intronic
1001213551 5:169833901-169833923 TTACTGCAGGGTAATCTGGTTGG - Intronic
1001765660 5:174244511-174244533 AGATTGCTGGGTCATATGGTGGG + Intergenic
1003408213 6:5840464-5840486 AACCTTCCAGGTCATCTGGTTGG - Intergenic
1005703393 6:28427223-28427245 GTGCTGCAGGGGCATCTGGTAGG - Intergenic
1007236680 6:40395468-40395490 AGCCTGCTAGGCCATCTGCTGGG + Intronic
1012241490 6:96877995-96878017 ATCCTGCGGGGTCAGCTCCTAGG + Intergenic
1013465311 6:110412828-110412850 ATCCTGTTGGTTCATCTCTTAGG - Intronic
1013465786 6:110415860-110415882 GCTCTGCTGGGTCAGCTGGTGGG + Intergenic
1014653038 6:124064887-124064909 TTCCTGCTGGGTTATCTGCCTGG + Intronic
1015522877 6:134148870-134148892 ATCCTGCTGTGTTATGTGGCAGG - Intergenic
1018299520 6:162386513-162386535 ATCTTGCTGATTCCTCTGGTGGG + Intronic
1018788531 6:167128131-167128153 ATCATGCTGGATTATCTAGTTGG - Intronic
1018816991 6:167340535-167340557 AGCCTGCTGAGTTATCTCGTGGG + Exonic
1020444412 7:8254493-8254515 CGTCTGCTGGGTCATCTAGTTGG + Intronic
1021624333 7:22577822-22577844 ATCCTGCTTGGTCAGCAGGCTGG + Intronic
1023387733 7:39677001-39677023 ATTATTCTGGATCATCTGGTTGG + Intronic
1026737209 7:72956606-72956628 ATGCTGCTGTGTCTTTTGGTAGG + Intergenic
1026787409 7:73310588-73310610 ATGCTGCTGTGTCTTTTGGTAGG + Intergenic
1027106523 7:75408462-75408484 ATGCTGCTGTGTCTTTTGGTAGG - Intronic
1027143635 7:75678709-75678731 TATCTGCTGGGCCATCTGGTTGG + Intronic
1030267216 7:107632710-107632732 ATTATCCTGGGTCATCTGCTTGG - Intergenic
1031314866 7:120243715-120243737 AACATCCTTGGTCATCTGGTAGG + Intergenic
1034480197 7:151314032-151314054 AGCCTCCTGGGTCAACGGGTGGG - Intergenic
1035528393 8:332678-332700 ATCATCCTGGATTATCTGGTTGG + Intergenic
1035565031 8:635599-635621 ATCCCGCAGGGTCCTCTGGCAGG - Intronic
1035608456 8:944925-944947 ATCCATGTGGGTGATCTGGTGGG + Intergenic
1036933704 8:12980345-12980367 ATCATCCTGGGTTATCTGGGTGG - Intronic
1037450996 8:19014880-19014902 CTCATGCTGGCTCCTCTGGTGGG - Intronic
1039276086 8:35935165-35935187 ACCCTGTTGGATCATCTGTTGGG - Intergenic
1039428429 8:37506136-37506158 ACCATGCTGGGTCATGTGGTAGG - Intergenic
1042204574 8:66316074-66316096 AAACTGCTGAGTCATATGGTAGG - Intergenic
1042574755 8:70205625-70205647 CTCCTTCTGGGTCTTCTGTTTGG - Intronic
1042771991 8:72391112-72391134 ATGTTGTTGGATCATCTGGTTGG - Intergenic
1044942685 8:97359714-97359736 ATTCTCCTGGGTTATCTGGATGG + Intergenic
1047252081 8:123188311-123188333 ATCATCCTGGGTTATCTGGTGGG - Intronic
1047312656 8:123705696-123705718 ATCCTGATGGCTCAGCTGGGTGG - Intronic
1049440911 8:142609355-142609377 AAGCTGCGGGGTCAGCTGGTGGG - Intergenic
1051490464 9:17658430-17658452 ATTCTGCTGGGTCATCACATTGG + Intronic
1051889019 9:21924584-21924606 ATCATGCTGCCCCATCTGGTTGG + Intronic
1052429324 9:28346561-28346583 AGATTGCTGGGTCATATGGTAGG + Intronic
1054755553 9:68953952-68953974 AGCCTTCTGGGACATCTGGCAGG + Intronic
1054868949 9:70031496-70031518 ATCTGGCTGGGTCATTTGTTGGG + Intergenic
1056078892 9:83069691-83069713 AGATTGCTGGGTCATATGGTAGG + Intergenic
1059346278 9:113631190-113631212 CTCCTTCTGGATCATCTGGAGGG - Intergenic
1061035769 9:128113667-128113689 ATTATCCTGGGTCATCCGGTGGG + Intergenic
1185494035 X:540741-540763 ATTATGCTGGGTTATCTGGCTGG - Intergenic
1185540857 X:902243-902265 ATCATGCTGGAGCTTCTGGTGGG + Intergenic
1185540883 X:902373-902395 ATCATGCTGGAGCCTCTGGTGGG + Intergenic
1185540892 X:902425-902447 ATCATGCTGGAGCTTCTGGTAGG + Intergenic
1185541019 X:902999-903021 ATCATGCTGGAGCTTCTGGTGGG + Intergenic
1185766135 X:2727283-2727305 ATCCTCCTAGGTCAGCTGGCAGG + Intronic
1186449681 X:9661743-9661765 AACTTGCTGGGTCATCTGCCAGG - Intronic
1186953944 X:14659565-14659587 ATCCTGCTGAGTTAGCTGGAGGG + Intronic
1187559599 X:20389410-20389432 ATCCTGGTGGGTAATTGGGTTGG + Intergenic
1187601309 X:20833753-20833775 CAACTGCTGGGTCATATGGTAGG + Intergenic
1191057740 X:56260184-56260206 ATCCTGCTGGATTATCTGGGTGG - Intronic
1192482684 X:71499046-71499068 CTTTTGCTGGATCATCTGGTTGG + Intronic
1195689145 X:107609769-107609791 AACCAGCTGGCTCATCTGATGGG - Intergenic
1197453552 X:126648164-126648186 ATTCTGCTAGGACATCTGGAAGG - Intergenic
1200274805 X:154721879-154721901 GGTCTGCTGGGTCATGTGGTAGG - Intronic
1200959378 Y:8983029-8983051 CTGTTGTTGGGTCATCTGGTTGG - Intergenic
1201496327 Y:14594231-14594253 CTTCTGTTGGATCATCTGGTTGG + Intronic