ID: 957128726

View in Genome Browser
Species Human (GRCh38)
Location 3:76196869-76196891
Sequence CTCACTAGGTATTAAGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957128724_957128726 -9 Left 957128724 3:76196855-76196877 CCTCACTATAAATGCTCACTAGG 0: 1
1: 0
2: 1
3: 9
4: 117
Right 957128726 3:76196869-76196891 CTCACTAGGTATTAAGTAAATGG 0: 1
1: 0
2: 1
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957128726 Original CRISPR CTCACTAGGTATTAAGTAAA TGG Intronic
900459754 1:2797236-2797258 CCCACTAGCTGTTCAGTAAACGG + Intronic
906099522 1:43249748-43249770 TTCACTGGCTATTAAGAAAATGG - Intronic
906802055 1:48746558-48746580 TTCACCAGGTGTTAAGCAAATGG - Intronic
907919405 1:58898763-58898785 CACAGTAGGTATTCAGTTAATGG + Intergenic
908044161 1:60150400-60150422 TTCACTAGGTAGAAAGTGAAGGG + Intergenic
908053510 1:60258551-60258573 CACAGTAGGTACTAAGTAAATGG + Intergenic
908599847 1:65726854-65726876 CTTACTAGGTAGTAAGTGCAAGG - Intergenic
909218563 1:72924876-72924898 TTCCCTAGGAAATAAGTAAAGGG + Intergenic
909299993 1:74000907-74000929 CCCACAAAGTATAAAGTAAATGG + Intergenic
909604918 1:77498301-77498323 GTGACTAGGAAGTAAGTAAATGG + Intronic
910715730 1:90227211-90227233 ATCTCTATGTATTCAGTAAATGG - Intergenic
910740652 1:90512473-90512495 CTCATTGGGTTTTAAGTAAATGG - Intergenic
910927197 1:92409706-92409728 CTCTCTGGGGATTAAGTAGAGGG - Intergenic
911520981 1:98930725-98930747 CTCATTAGTGAGTAAGTAAAGGG + Intronic
911531876 1:99052443-99052465 CTCAATAGCTACTAAGTAAGGGG - Intergenic
911804624 1:102190335-102190357 CTCACTAGTAATTCAGTAAGTGG + Intergenic
912809174 1:112780891-112780913 CTCAGAATGTATTAAGTAGAAGG - Intergenic
913551475 1:119920940-119920962 TGTACTAGGTATTCAGTAAAGGG - Intronic
915541662 1:156570992-156571014 CTCACTTGGGATTAAGTGGAAGG + Intronic
915652339 1:157324973-157324995 CTCAGTAGGTATCATATAAATGG + Intergenic
915883941 1:159703018-159703040 TTCACTAGGTATGAAGCAAGTGG - Intergenic
916751499 1:167726650-167726672 CTGACTAGTAAATAAGTAAAAGG - Intronic
920058823 1:203213643-203213665 CTCAGTCGGTATTAACTAAAAGG + Intronic
920461437 1:206143742-206143764 CTCACCAGATATTAAGTTACAGG + Intergenic
921553195 1:216564511-216564533 CTCAATAGGTATATATTAAACGG + Intronic
921939965 1:220829208-220829230 CTCACTAAGTATTTAGCAAAGGG - Intergenic
921963374 1:221060373-221060395 CTCACTAGTTATAAAGTCAATGG - Intergenic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1063779755 10:9308229-9308251 CTCACTGGGTATTAGCTAATTGG - Intergenic
1064452137 10:15452280-15452302 CTTACTAGGTACTCATTAAAAGG - Intergenic
1068012834 10:51476070-51476092 CACACTATGAATTAAGTCAATGG - Intronic
1068022070 10:51597406-51597428 CTCAATAGCTCTTAAATAAATGG - Intronic
1068191522 10:53658693-53658715 CACAATAGGTGTTAAGTAAATGG - Intergenic
1073034746 10:100555757-100555779 GTGAATAGGTTTTAAGTAAACGG - Exonic
1076492896 10:130875611-130875633 ATCACTAGGTATTCTGGAAAAGG + Intergenic
1077781216 11:5331847-5331869 CTCACTAGCTATTTTTTAAATGG + Intronic
1079662925 11:23064253-23064275 GTTACTAGGGATTAAGGAAAGGG - Intergenic
1082889952 11:58128111-58128133 ATCACTAGATATTATGAAAAGGG + Intronic
1088175252 11:107046193-107046215 CACAGTAGGCATTCAGTAAATGG - Intergenic
1088448467 11:109956945-109956967 TTCATTAGTTATTATGTAAAAGG - Intergenic
1093695929 12:22160468-22160490 CCCACTAGGTATTATGTCTAGGG - Intronic
1093749672 12:22783609-22783631 CTCACTAATTAGTAAGTAATTGG - Intergenic
1094048827 12:26196676-26196698 CACAGTAGGTATTCAGTAAGTGG - Intronic
1094364924 12:29670310-29670332 CACAGTAGGTATTCATTAAATGG - Intronic
1095160703 12:38911802-38911824 CCCACTGGCTATTCAGTAAAGGG + Intergenic
1098033659 12:66280444-66280466 CGCAGTAGGTACTCAGTAAATGG - Intergenic
1098853399 12:75624537-75624559 TTCAATAGGTATTAGATAAAAGG + Intergenic
1100664489 12:96736476-96736498 CTCACTAAGAACTAAGAAAAGGG + Intronic
1106708423 13:32305950-32305972 CTCACAGGGTATTGAGTTAATGG + Intronic
1106708778 13:32309847-32309869 CTCTCTAGGTCTCTAGTAAATGG + Intronic
1111066717 13:83103402-83103424 CTGCCTAGGAAGTAAGTAAAAGG - Intergenic
1112668973 13:101613218-101613240 CTTACAAGGTTTTAAGTAGATGG + Intronic
1112806090 13:103165282-103165304 GTGACTACTTATTAAGTAAAAGG + Intergenic
1112992100 13:105526224-105526246 CTCCCTAGGCATAAAGTTAATGG - Intergenic
1116145706 14:41065577-41065599 CTCACTGGGTTACAAGTAAAAGG - Intergenic
1116622534 14:47224505-47224527 TTCACTAGACATTAATTAAATGG - Intronic
1120099342 14:80426268-80426290 CTCAAAAAATATTAAGTAAATGG - Intergenic
1121160300 14:91732611-91732633 CTCACTCGGTACTCAGTCAAAGG - Intronic
1122065283 14:99168845-99168867 CTCCCTGGGTATTGAGAAAATGG + Intergenic
1125155978 15:36586244-36586266 CCCACAAGGTATTTATTAAAAGG - Intronic
1126173151 15:45711095-45711117 CTCACTAGTTATAAAATAGATGG + Intergenic
1126721018 15:51579833-51579855 CATAGTAGGTATTCAGTAAATGG - Intronic
1130767125 15:86881887-86881909 CTCACTAGGTAGTACCAAAAGGG + Intronic
1131146225 15:90014831-90014853 CTCTTTAGATATTAAGGAAATGG - Intronic
1133681121 16:8120910-8120932 CTGCCTAGGTAGTAAGAAAAAGG - Intergenic
1144333939 17:14252244-14252266 CTCATGAGTTATTAAATAAATGG - Intergenic
1147988056 17:44317825-44317847 CTCACTGTGTATTTAATAAATGG + Intronic
1150412788 17:64960944-64960966 ATCACCAGGTATTAAGCAAAGGG - Intergenic
1150799049 17:68264290-68264312 ATCACCAGATATTAAGCAAAGGG + Intronic
1150950554 17:69798908-69798930 CTCACTGGTGATTAGGTAAAAGG + Intergenic
1151082860 17:71348214-71348236 TTCAGTAGGAATTAAGGAAATGG - Intergenic
1157449861 18:47777701-47777723 ATCACTAGCTATTAAGGAAATGG + Intergenic
1157536076 18:48458416-48458438 CTCACTAGGGATAAAGCTAATGG - Intergenic
1159972729 18:74673680-74673702 GTCAGTAGGTATTTATTAAAGGG + Intronic
1163589475 19:18183988-18184010 CTCACTAGTTTTTAAAAAAATGG + Intergenic
1168586266 19:57595752-57595774 TGCACTAGATATTAAGGAAATGG + Intergenic
929745130 2:44649282-44649304 CTCAGTAGGTACTCAATAAATGG - Intronic
931503047 2:62891763-62891785 TTCACTAGGTTTTAAGTTTATGG + Intronic
932967619 2:76495968-76495990 CTCACTGGATATTTAATAAAGGG - Intergenic
936594836 2:113838136-113838158 CTCACTAGGCACTATGTCAAGGG + Intergenic
939246424 2:139630039-139630061 GTCAATAAGTATTAACTAAATGG + Intergenic
940732859 2:157414269-157414291 CCAACTAGGTACTCAGTAAATGG + Intergenic
942795785 2:179817341-179817363 CTCACCAGGTATATATTAAAAGG + Intronic
942852454 2:180505152-180505174 CTCAGTAGGTCTTAAGTGAAGGG + Intergenic
944928085 2:204485741-204485763 CTCAATAGGTATTTAGGGAAAGG - Intergenic
944928366 2:204489800-204489822 CTCAATAGGTATTTAGGGAAAGG - Intergenic
946868865 2:224068008-224068030 CTCACCAGGTCTTGAGGAAAGGG + Intergenic
1168884199 20:1234398-1234420 CAGAGTAGGTATTCAGTAAATGG - Intronic
1169719751 20:8661692-8661714 CACACTAGTCATTCAGTAAATGG + Intronic
1170002481 20:11630364-11630386 CTGACTAGGCAGTAAATAAATGG - Intergenic
1171313485 20:24165847-24165869 TTCACAAGGTATTGAGTACAAGG + Intergenic
1172897529 20:38310967-38310989 CTCACTAGGTATTTGTTGAATGG - Intronic
1173016460 20:39230248-39230270 CTGCCTATGTATTATGTAAATGG - Intergenic
951292757 3:20893711-20893733 CACAGTAAGTATTCAGTAAATGG + Intergenic
951878988 3:27462030-27462052 CTCACTAGATATTCAACAAATGG + Intronic
953831980 3:46306963-46306985 CTCTCTAACTATTAAGGAAATGG - Intergenic
955819887 3:62885621-62885643 CTCAATGTGTATTAAGTCAATGG - Intergenic
956459945 3:69461937-69461959 CTTACTAAGTATAAAATAAATGG - Intronic
957128726 3:76196869-76196891 CTCACTAGGTATTAAGTAAATGG + Intronic
958569269 3:95859236-95859258 GTCAATATGTAATAAGTAAATGG + Intergenic
959985194 3:112564064-112564086 CTTACTAGTTATTGAGTGAAGGG + Intronic
960238226 3:115309806-115309828 TTCACTATGTTTTATGTAAATGG + Intergenic
960473112 3:118092605-118092627 CTTACTAGGTATTTATTGAATGG + Intergenic
961122899 3:124388523-124388545 CTCAATAAGTATTGAATAAATGG + Intronic
964158436 3:153615999-153616021 CTCATTAGGTTTTACATAAAGGG + Intergenic
965248085 3:166301925-166301947 CACAGTAGCTATGAAGTAAATGG - Intergenic
966634243 3:182114622-182114644 CACACTATGTATTAAACAAATGG - Intergenic
970851684 4:20611396-20611418 CATACTAGGAACTAAGTAAATGG + Intronic
975445978 4:74466133-74466155 ATCCTTAGGTATTAAGGAAAAGG + Intergenic
976657200 4:87501457-87501479 CAAACTATGTATCAAGTAAAGGG - Intronic
977314544 4:95429254-95429276 ATCACTAAGTATTATTTAAAGGG - Intronic
978674752 4:111298991-111299013 CTGACTTGGTCTTGAGTAAAAGG + Intergenic
979841855 4:125451643-125451665 CTCAGCAAGTAATAAGTAAAGGG - Exonic
979904810 4:126274004-126274026 GTCAGTAGGTATTAAGCATATGG - Intergenic
981125617 4:141102883-141102905 TTCACTAGGTATTACTAAAATGG + Intronic
981320838 4:143389312-143389334 CTCACTAGGTTTTAATTAAAAGG - Intronic
981522138 4:145674083-145674105 GTCAATAGGTATTAATTAAAAGG - Intergenic
983541045 4:168910658-168910680 CCCATTAGGTATTAACTATATGG + Intronic
988328849 5:29808271-29808293 CTTACTGGGTATGAAGTAGATGG - Intergenic
989009456 5:36853784-36853806 CTTACTTGCTATTAAATAAATGG + Intergenic
992433723 5:76735001-76735023 CTCATTAAGTCTTAAGTAAATGG - Exonic
992744676 5:79807469-79807491 CTCACTATAAATTAAGCAAATGG - Intergenic
993176560 5:84494267-84494289 CTTAGTAGGTATTTATTAAAAGG + Intergenic
995607632 5:113874471-113874493 TTCACTTGGTATTAAGAAAATGG + Intergenic
997315030 5:132925687-132925709 CTCACTAGCAATCAAGCAAATGG + Intronic
998201231 5:140124279-140124301 CTCACTTGGTTTTAAGTATGAGG - Exonic
998381876 5:141731493-141731515 CTCACTAACTATTCAGGAAATGG - Intergenic
1000722798 5:164729323-164729345 CTCACTAGGTAAGAAGTCATGGG + Intergenic
1001430246 5:171655246-171655268 CTCACAGCGTATTAACTAAAGGG - Intergenic
1003176760 6:3757821-3757843 CTCACTAAATATTTATTAAATGG + Intergenic
1003698890 6:8440417-8440439 CTCAATAAGTATTTATTAAATGG - Intergenic
1006463151 6:34175700-34175722 CACAATAGGTACTCAGTAAATGG - Intergenic
1008342526 6:50384839-50384861 CCCACTAAGTATTAATTCAAAGG + Intergenic
1013176358 6:107680656-107680678 CTCACCAGGCAATAAATAAAAGG - Intergenic
1013190253 6:107797279-107797301 CTCAAGAAGTCTTAAGTAAATGG - Intronic
1014898683 6:126935594-126935616 CAGAGTAGGTATTAATTAAAAGG + Intergenic
1017551738 6:155516983-155517005 ATCACTAGGTATTCTGGAAAAGG - Intergenic
1017602454 6:156098395-156098417 CTCACTATGCATTTAGTGAATGG + Intergenic
1018122264 6:160646919-160646941 TTCACTAGGTTTTGAGTACATGG - Intronic
1018501145 6:164412204-164412226 CTCACTCTGTTTTAAGTAGAAGG - Intergenic
1019163026 6:170081451-170081473 CTCACTTGTTTTTAAGAAAAGGG - Intergenic
1021413605 7:20356113-20356135 GTTACGAGGGATTAAGTAAATGG - Intronic
1028244831 7:88464384-88464406 TTCACTATATATTCAGTAAATGG + Intergenic
1029906609 7:104099615-104099637 GACACTGGGTATTAAGTGAAAGG - Intergenic
1030692357 7:112548266-112548288 CTCACTGGGTATGAAGGAAATGG - Intergenic
1030730173 7:112978583-112978605 CTCACAAGGCATAAAGGAAATGG - Intergenic
1030772824 7:113496125-113496147 CTCACAAGGCATAAAGGAAATGG - Intergenic
1033648057 7:143320274-143320296 CCCTCTAAGTATTAAGGAAAAGG + Intronic
1035661809 8:1353947-1353969 GTCACTAGCTATGAAGTAAGTGG + Intergenic
1037292512 8:17366281-17366303 TTCCCTAGGTATCAAGTTAAAGG + Intronic
1041784404 8:61615556-61615578 CTCACTATGTACTCAATAAATGG + Intronic
1042300433 8:67274058-67274080 CACAGTAGGTATTTAATAAATGG - Intronic
1051214875 9:14786296-14786318 CTCCCTAGGTATTAAAGACAGGG - Intronic
1052297652 9:26915878-26915900 CTCACTTGGTATTAAGTTTCAGG + Intronic
1053392105 9:37743235-37743257 CTCATTAGGTATTCACTAAAAGG - Intronic
1056070278 9:82979156-82979178 CTGTCTATGTAATAAGTAAAAGG + Intergenic
1056617143 9:88178472-88178494 CTCATTAGGTATTCTGGAAAAGG + Intergenic
1058785784 9:108385419-108385441 CTCACTATCTATAAAATAAAGGG + Intergenic
1061150913 9:128827543-128827565 CTCACTAGGGATCAGGTTAATGG - Intronic
1187630431 X:21163436-21163458 CTAACTAGATTTTAATTAAAAGG + Intergenic
1190788565 X:53677923-53677945 TTCAGTAGTCATTAAGTAAATGG - Intronic
1192032002 X:67523876-67523898 CTCATTAGGTTTTCAGTAAAGGG - Intergenic
1193377631 X:80780552-80780574 CTCACTAAATATTAAATAGATGG - Intronic
1193731544 X:85108872-85108894 CTCACTTGGTATGAACCAAATGG - Exonic
1194793454 X:98180148-98180170 CTCATGATCTATTAAGTAAAAGG + Intergenic
1196487791 X:116233662-116233684 CTGGCTAGGTACTCAGTAAAGGG + Intergenic
1198420599 X:136467940-136467962 CTCACAAAGTGTTAAGTCAAGGG + Intergenic
1198848485 X:140939507-140939529 CTCAATAAGTATTTACTAAATGG - Intergenic
1199825856 X:151498550-151498572 CTCACTAGTAAGAAAGTAAAAGG + Intergenic