ID: 957129024

View in Genome Browser
Species Human (GRCh38)
Location 3:76199477-76199499
Sequence GTAGGTCAGAGGTTCTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957129024_957129032 26 Left 957129024 3:76199477-76199499 CCCATATAGAACCTCTGACCTAC 0: 1
1: 0
2: 2
3: 16
4: 150
Right 957129032 3:76199526-76199548 TGTTCAAGCTGTTGAATTGTTGG 0: 1
1: 1
2: 1
3: 13
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957129024 Original CRISPR GTAGGTCAGAGGTTCTATAT GGG (reversed) Intronic
905887252 1:41497961-41497983 TTAGGCCACATGTTCTATATGGG + Intergenic
907548680 1:55285664-55285686 GTAGGTCAGAAGTCCAAAATGGG - Intergenic
909381337 1:75002340-75002362 GGAGGTCAGAGGTTCAAAATGGG + Intergenic
910611544 1:89148748-89148770 GTAAGTCAGAAGTTCTTTTTAGG - Intronic
911931875 1:103914875-103914897 GGAGGTCAGAAGTTTTAAATGGG + Intergenic
916016272 1:160752468-160752490 GTAGGACAGAGGTTCTAGATCGG + Intronic
918333779 1:183487135-183487157 GGAGGTCAGAGGTCCAAAATGGG + Intronic
921687947 1:218112232-218112254 GTAGAGCAGAGGTTCAATGTTGG + Intergenic
922154490 1:223030400-223030422 GTAGGTCAGGGGTTTTTTAAAGG + Intergenic
924663911 1:246050129-246050151 AAAGATCAGAGGTTCCATATAGG + Intronic
924747424 1:246849063-246849085 GTAGGTCAGAGCTTCTCAACAGG - Intronic
1062807600 10:435925-435947 GTAGGTTTAAAGTTCTATATAGG - Intronic
1064462254 10:15546449-15546471 TTAGGTCAGTGGTTCAAAATGGG + Intronic
1064627468 10:17275853-17275875 GGAGGTCAGAAGTTCAAAATAGG + Intergenic
1064871963 10:19947241-19947263 GGAGGTCAGAGGTTCAAAACTGG - Intronic
1069308670 10:67005474-67005496 ATAGGCCATAGGTTTTATATGGG + Intronic
1070261156 10:74857221-74857243 GTAGGTCAGAAGTCCAACATGGG + Intronic
1070348102 10:75565195-75565217 GCAGGTCGGAGGTTCTTTGTGGG + Intronic
1070471177 10:76781256-76781278 GGAGGTCAGACGTTCAAAATGGG + Intergenic
1070472443 10:76796148-76796170 GGAGGTCAGAAGTTCGAAATGGG - Intergenic
1071451791 10:85799730-85799752 GAAGGGCAGAGGTTGTTTATTGG + Intronic
1074717035 10:116229117-116229139 GTAGGCCAGAGGTCCAACATGGG - Intronic
1075993729 10:126859773-126859795 GGAGGTCAGAGGTCCAAAATGGG + Intergenic
1079775068 11:24514928-24514950 TTAGGTCAGAGGTCCTAAAGAGG + Intronic
1083580396 11:63821091-63821113 GGAGGTCAGAGGTCCAAAATGGG + Intronic
1085168165 11:74423526-74423548 GGAGGTCAGAAGTTCAAAATGGG - Intergenic
1086121118 11:83305275-83305297 GGAGGTCAGAGGTCCCAAATGGG - Intergenic
1089088397 11:115844192-115844214 GTAGGTCAGAAGTCTGATATGGG + Intergenic
1090196567 11:124821658-124821680 TTAGGTCAGAGGCTCTATCCAGG - Intergenic
1092328458 12:7560058-7560080 GTATGTGACAGGATCTATATTGG - Intergenic
1092806719 12:12230685-12230707 GTAAGTCAGAGTTTCTATTCTGG + Intronic
1095203281 12:39410265-39410287 GGAGGTCAGAAGTTCAAAATTGG - Intronic
1101740797 12:107498493-107498515 GTAGGTCAGAAGTCCAAAATGGG + Intronic
1102090506 12:110183412-110183434 GCAGGTCAGACGTTTGATATTGG + Intronic
1106357954 13:29002057-29002079 GGAGGTCAGAAGTTCAAGATGGG - Intronic
1107661751 13:42646098-42646120 GTAGGTCACATTTTCTATTTAGG + Intergenic
1108013249 13:46044843-46044865 TTTGGTCAGATTTTCTATATTGG - Intronic
1110509114 13:76328125-76328147 GGAGGTCAGAAGTTCAATGTGGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1115998111 14:39214382-39214404 ATAGGTCAGAAGTCCAATATAGG - Intergenic
1118042365 14:61930963-61930985 GTAGGTCAGAAGTCCAAAATGGG - Intergenic
1120548050 14:85834134-85834156 GAAAATCAGAGGTTCTATAGAGG - Intergenic
1127356103 15:58201456-58201478 GTAGGTCAGAAGTCCCACATGGG - Intronic
1129174639 15:73831173-73831195 GGAGGTCAGTGGTTCCATCTTGG - Intergenic
1131192063 15:90324786-90324808 GTAAGACAGAGGATCTATTTGGG - Intergenic
1133860912 16:9594472-9594494 GTAGGAGAGAGGTTTTAAATGGG - Intergenic
1136077158 16:27825046-27825068 GTAGGTCAGGTGTTCAATCTCGG - Intronic
1137772936 16:51031865-51031887 GTAGGTCATAGGGTCTGTAGTGG - Intergenic
1137914852 16:52418511-52418533 ATAGGTAAGAGGATCTCTATGGG + Intergenic
1140805900 16:78532030-78532052 GTAGGTCAGAAGTGGTATTTGGG + Intronic
1143691029 17:8566171-8566193 CTAGGTCAGTGGTTCTTAATTGG - Intronic
1144733850 17:17543882-17543904 CAAGCTCAGAGGTTCTATTTTGG - Intronic
1149361753 17:55902359-55902381 TTAGGTGACAGGTTGTATATAGG + Intergenic
1153410460 18:4787129-4787151 GTAGGTCAGAAGTCCAACATAGG + Intergenic
1154939897 18:21101584-21101606 CTAGGTCAGTGGTACTATACAGG - Intronic
1157939872 18:51916830-51916852 CAAGGTCAGAGGTCCTATATTGG - Intergenic
1158400931 18:57121219-57121241 GTATGGCAGGGGTGCTATATGGG + Intergenic
1162866206 19:13549163-13549185 CTGGATCAGAGGTTGTATATAGG - Intronic
1164625588 19:29725597-29725619 GTAGCTGAGCGGTTCTAGATTGG + Intergenic
1165148148 19:33745220-33745242 GGAGGTAAGAGTCTCTATATAGG + Intronic
1168672624 19:58252573-58252595 GTAGTTCAGAGGTTGTCTAAAGG - Intronic
926067704 2:9857507-9857529 GAAGGTCAGTGGTTCCATTTTGG + Intronic
926435521 2:12833916-12833938 GAAGGTCAGAGGTCATATAGAGG - Intergenic
927654361 2:24932954-24932976 GAAGGTCAGAGGTCCAAAATCGG + Intergenic
929054969 2:37868836-37868858 GGAGGTCAGAAGTTCAAAATGGG + Intergenic
929227908 2:39529375-39529397 GTAGGCCACAGATTTTATATGGG - Intergenic
932635021 2:73380513-73380535 GTAGGTCTCATGTTCCATATGGG + Intergenic
932701001 2:73991568-73991590 GTAGATCAGGGGTTCCACATTGG + Intronic
932701194 2:73993045-73993067 GTAGATCAGGGGTTCCACATTGG + Intronic
933328603 2:80869427-80869449 GGAGGTCAGAAGTCCTAAATGGG - Intergenic
934061443 2:88297889-88297911 GGAGGTCAGAAGTCCAATATGGG + Intergenic
935868968 2:107424502-107424524 GTAGGTCTGAAGGTCTATGTTGG - Intergenic
937113329 2:119384432-119384454 GGAGGTCAGAAGTTTGATATGGG - Intergenic
937867572 2:126765311-126765333 GTTGGTCAGAGGTTATACAGGGG + Intergenic
938728627 2:134129089-134129111 GTAGGTCAGAGGTCCCTTATGGG + Intronic
939872543 2:147541305-147541327 GTAGGTCAGAAGATCTATGAAGG + Intergenic
939877427 2:147593887-147593909 GCAGGTCAGAAGTTCAAAATGGG + Intergenic
940041136 2:149362104-149362126 GAAGGTCAGAAGTCCAATATGGG - Intronic
940049870 2:149451000-149451022 GTTGGTCAGAGCTAGTATATAGG + Intronic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
941256507 2:163238599-163238621 TTAGGTGAAATGTTCTATATGGG + Intergenic
941468487 2:165857268-165857290 GGAGGTCAGATGTTCAAAATGGG - Intergenic
943931684 2:193862274-193862296 GTGGGTCAGAAGTTTGATATGGG - Intergenic
944079776 2:195773991-195774013 GTAGTTCAGTGATTCTAGATTGG - Intronic
944484635 2:200192239-200192261 GTAGGTCAGAAGACCTGTATGGG + Intergenic
945156235 2:206841916-206841938 GTAGGGCAGTGGTTCTTAATTGG + Intergenic
948142820 2:235686369-235686391 GGAAGGCAGAGCTTCTATATTGG + Intronic
1170413882 20:16120086-16120108 GTAGGTCAGAAGTCCAATGTGGG + Intergenic
1170955307 20:20974203-20974225 GGAGGTCAGAAGTTCAAAATGGG + Intergenic
1173544498 20:43884313-43884335 GTAGGTTAGATGTTCAATATGGG + Intergenic
1174505686 20:51016045-51016067 GGAGGTCAGAGGTTGGAAATGGG - Intronic
1176924379 21:14729735-14729757 CTAGGCTAGTGGTTCTATATTGG - Intergenic
1177383206 21:20372212-20372234 GTAGGTCAGAAGTTTGACATAGG - Intergenic
1179660401 21:42870965-42870987 GTAGGTCAGGGCTTCAACATAGG - Intronic
1181185406 22:21099879-21099901 GTTGGTCAGTGGATATATATGGG - Intergenic
952034693 3:29186137-29186159 ATACATCAGAGGTTCAATATAGG + Intergenic
952487212 3:33825033-33825055 GTAGGTCAGATGTTTTAGATTGG + Intronic
955865900 3:63383592-63383614 GGAGGGCAGTGGTTCTATCTCGG - Intronic
956957762 3:74360591-74360613 GGAGGTCAGAAGTTCAGTATAGG + Intronic
957129024 3:76199477-76199499 GTAGGTCAGAGGTTCTATATGGG - Intronic
962305468 3:134282231-134282253 GTAGTTCAGAAGTTCAAAATAGG - Intergenic
963204477 3:142618448-142618470 GTAGGTCAGAAGTTTGATACAGG + Intronic
964334212 3:155637751-155637773 GTAGGTGAGAGGTTCTTTCTTGG - Intronic
964920967 3:161895203-161895225 GTAAGTCATAGCTTCTATATAGG + Intergenic
965105786 3:164350676-164350698 GTAGATCAGTGGCTCTAAATAGG - Intergenic
971573199 4:28240107-28240129 GTTGGTGAGAAGTTTTATATAGG - Intergenic
973307799 4:48672572-48672594 GTAAGTATGAGGTTCTATCTTGG + Intronic
974101334 4:57421043-57421065 GTAGTTCAGAAAGTCTATATAGG - Intergenic
975254694 4:72218763-72218785 GTAGGTCAGAAGTCCAACATGGG - Intergenic
975709948 4:77151065-77151087 GGAGGTCAGAAGTTCAAAATGGG - Intergenic
979200546 4:117972982-117973004 GTAGGTTTGAGAGTCTATATAGG - Intergenic
979225925 4:118284307-118284329 CTAGGTCAGAGGTTCTCAACTGG - Intronic
979684736 4:123499402-123499424 GTAGGTATGGGGTTATATATGGG - Intergenic
979942204 4:126775673-126775695 GGAGGTCAGAAGTTCAAAATGGG - Intergenic
990396491 5:55385328-55385350 GTTGGCCAGAGGCTCTATCTTGG - Intronic
990592615 5:57281649-57281671 GTAGGTCAGAAGTCCGACATGGG - Intergenic
990736798 5:58873152-58873174 GTAGGTCTGAGGTTGGATCTGGG - Intergenic
991121015 5:63013662-63013684 GTAGATCATAGGTTCTTTACTGG + Intergenic
992028556 5:72696589-72696611 CTAGGTCAGTGGTTCTCAATGGG - Intergenic
994559938 5:101355612-101355634 GAGGGACAGAGGTTGTATATGGG + Intergenic
994639602 5:102390454-102390476 GTAAATCAGAGGTTCTAAAATGG + Intronic
997797074 5:136820971-136820993 GTAGCTCAGAAGTTCTATGTTGG + Intergenic
998987020 5:147770327-147770349 CTGGGTCAGAGGTTCTAAATGGG + Intronic
1000139077 5:158383781-158383803 GTATGGTAGATGTTCTATATTGG - Intergenic
1007187183 6:39981893-39981915 TTAGGTCAGAGGTTGTATGATGG + Intergenic
1007246248 6:40465279-40465301 GTAGTTCAGAAGTTCAAAATGGG - Intronic
1013861451 6:114640572-114640594 GTAAGTCAAAGGTTCAATACTGG - Intergenic
1015499451 6:133917305-133917327 GGAGGTCAGAAGTTTTAAATTGG - Intergenic
1016198697 6:141379699-141379721 GTAGGTGGGAGGATATATATAGG + Intergenic
1016589001 6:145722479-145722501 AGAGCTCAGAGTTTCTATATGGG + Intronic
1018047052 6:159974792-159974814 GTAGGCCAGTGGTTCTCAATTGG - Intronic
1019356281 7:581250-581272 GGAGGTCAGTGGTGCTATCTCGG - Intronic
1020160392 7:5766378-5766400 GGAGGTCAGAGCTTCAATATAGG - Intronic
1021654266 7:22859399-22859421 GTTTAACAGAGGTTCTATATTGG - Intergenic
1030349459 7:108467892-108467914 GTAGCTCAGAGTTTCTAAAAGGG + Intergenic
1030979279 7:116167103-116167125 GTAGGTCAGAAGTCCTACAAAGG - Intergenic
1031446171 7:121857597-121857619 GTAGGTCAGAAGTTTGACATGGG + Intergenic
1032853417 7:135814361-135814383 GTAGGTCAGAAGTCCAATATGGG - Intergenic
1033146747 7:138877441-138877463 GTAGGGCAGTGGTGCTATCTTGG - Intronic
1033436813 7:141340271-141340293 GTAGGTCAGAAGTCCAAAATGGG - Intronic
1033858932 7:145600486-145600508 GTAGGTCAGAAGTCTTACATGGG - Intergenic
1035840360 8:2805457-2805479 GGAGGTCAAAGGGTGTATATTGG + Intergenic
1036015460 8:4778619-4778641 GAAGGTCAGAGGGTCAATAGTGG - Intronic
1036087041 8:5623670-5623692 GTAGGTCAGAAGTCCAATATAGG - Intergenic
1042353593 8:67802301-67802323 GAAGATCAGAAGTTCAATATGGG + Intergenic
1042925989 8:73969181-73969203 ATAAATCAGAAGTTCTATATGGG - Intronic
1043352178 8:79374674-79374696 GAAGGTCAGAAGTCCTAAATGGG + Intergenic
1044071948 8:87772036-87772058 GAAGGAAAGAGGTTCTACATGGG - Intergenic
1044769858 8:95619764-95619786 GTAGGTCAGAAGTGCAAAATGGG - Intergenic
1046686091 8:117228358-117228380 GAAGGTCAGAGGGTCTCTTTAGG + Intergenic
1050209331 9:3235526-3235548 GGAGGTCAGAAGTTCTAAATGGG + Intronic
1051567750 9:18519425-18519447 TTAGGTGGGAGGTCCTATATGGG - Intronic
1051698912 9:19798017-19798039 TTAGGTCAGAGGTCTTGTATGGG + Intergenic
1052332866 9:27288210-27288232 GTAGGACAGAGGTTTTTTTTGGG + Intronic
1052505547 9:29349464-29349486 GTAGGTCAGAAGTTTGAAATGGG - Intergenic
1053052477 9:34973120-34973142 CTAGCTCAGAGGTTCTCTACCGG - Intronic
1054742881 9:68826553-68826575 GGAGGTCAGAGGTTGTAAACTGG - Intronic
1056271149 9:84949172-84949194 GTAGTTCAGAGGATCTACAGTGG + Intronic
1058814985 9:108674856-108674878 GAAGGGCAGAGGTTGAATATGGG - Intergenic
1059685318 9:116629493-116629515 GTAGGGCAGAGGGTCTATTTTGG + Intronic
1186765246 X:12763913-12763935 GGAGGTCAAAGGTTCAAAATGGG + Intergenic
1189715200 X:43857968-43857990 TTAGATCAGAGGTTCTAAATTGG - Intronic
1190369965 X:49731088-49731110 ATAGGAAAGAGGTTCCATATAGG - Intergenic
1192743111 X:73912552-73912574 GAAAGCCAGAGGTTCTAAATGGG - Intergenic
1193332035 X:80245553-80245575 GTAGGTCAGAAGTTCAACATGGG - Intergenic
1195409675 X:104556099-104556121 GTAGGGCAGAGGTTCCATGCTGG + Intergenic
1198267574 X:135023443-135023465 GTAGGTCAGAAGTTCCATATGGG + Intergenic
1200782730 Y:7231548-7231570 GTAAGTCAGAAGTTCTTAATGGG + Intergenic