ID: 957129035

View in Genome Browser
Species Human (GRCh38)
Location 3:76199564-76199586
Sequence ATGAATGTACAAATGGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 792
Summary {0: 1, 1: 0, 2: 12, 3: 99, 4: 680}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957129030_957129035 22 Left 957129030 3:76199519-76199541 CCCGTATTGTTCAAGCTGTTGAA 0: 1
1: 0
2: 0
3: 12
4: 114
Right 957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG 0: 1
1: 0
2: 12
3: 99
4: 680
957129031_957129035 21 Left 957129031 3:76199520-76199542 CCGTATTGTTCAAGCTGTTGAAT 0: 1
1: 0
2: 0
3: 15
4: 143
Right 957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG 0: 1
1: 0
2: 12
3: 99
4: 680
957129029_957129035 23 Left 957129029 3:76199518-76199540 CCCCGTATTGTTCAAGCTGTTGA 0: 1
1: 0
2: 0
3: 4
4: 63
Right 957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG 0: 1
1: 0
2: 12
3: 99
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957129035 Original CRISPR ATGAATGTACAAATGGATAA TGG Intronic
900821567 1:4893503-4893525 ATCAATGAATGAATGGATAAAGG + Intergenic
900857004 1:5194324-5194346 ATGAACAAACAAATAGATAAAGG + Intergenic
901001213 1:6149647-6149669 ATGAATGGATAAATGGATGATGG + Intronic
901001228 1:6149741-6149763 ATGGATGGACAAATGGAAATGGG + Intronic
901001297 1:6150140-6150162 ATGGGTGGACAAATGGATGATGG + Intronic
901001300 1:6150159-6150181 ATGGATGGACAAATGGATGATGG + Intronic
901001319 1:6150278-6150300 ATGGATGGACAAATGGATGATGG + Intronic
901673729 1:10870665-10870687 ATGAATATCCAAATGAATGAAGG - Intergenic
902342820 1:15795478-15795500 ATGAATGTGCAAATGAAAACTGG - Intergenic
902358717 1:15929049-15929071 ATGAAAGTACCAAAGGAAAAGGG + Exonic
902721175 1:18305196-18305218 ATGGATGGATGAATGGATAATGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903579157 1:24358108-24358130 ATGAATGTGTAAATGAATGAAGG + Exonic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904956983 1:34292795-34292817 ATGGATGAACAAATGGATGTGGG + Intergenic
905117604 1:35655854-35655876 ATGAATATACAAAGGGATATGGG + Intergenic
905382133 1:37570196-37570218 ATGAATGGACTAATGGATCTCGG + Intronic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906508780 1:46399097-46399119 CTGCATGTACAAAGGCATAAGGG - Intronic
906557558 1:46725676-46725698 ATGAATGAATGAATGAATAAAGG - Intergenic
907114001 1:51952657-51952679 AGGAATGAATAAATGAATAAAGG + Intronic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
907919763 1:58901673-58901695 ATGAGTGGACAGATGGATGATGG - Intergenic
908151659 1:61309017-61309039 ATGAGTGTGCAAATGGAAAACGG - Intronic
908235488 1:62143813-62143835 CTGAGTGTGCAAGTGGATAATGG + Intronic
908578313 1:65485725-65485747 CTGACTGTACAAATTGGTAATGG - Intronic
909615544 1:77604856-77604878 ATACGTGTATAAATGGATAATGG - Intronic
909841317 1:80328850-80328872 ATGAATGTAGAAATGAATATGGG + Intergenic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910645769 1:89513567-89513589 AAAAATGGACAAATGGACAAAGG - Intergenic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
915351433 1:155229037-155229059 TGGAATGTGCAAATGGGTAATGG + Intergenic
915354216 1:155246217-155246239 TGGAATGTGCAAATGGGTAATGG + Intergenic
916387095 1:164286963-164286985 ATGAATGTACAAATAAAACATGG - Intergenic
916601736 1:166299709-166299731 ATGAATATTCAAAGGAATAAGGG + Intergenic
916798988 1:168196660-168196682 ATGAATATACTAATTGATACTGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917784514 1:178439320-178439342 ATAAATGTACAAATGCCTAAGGG - Intronic
918070567 1:181131008-181131030 ATAAATGAATAAATGGAGAATGG - Intergenic
918637240 1:186792431-186792453 ATGAATGAACAAATATATAATGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919270709 1:195340297-195340319 ATAAATGGGTAAATGGATAATGG - Intergenic
920722271 1:208398896-208398918 ATGAATGAATGAATGGATGATGG - Intergenic
921730313 1:218570824-218570846 ATGAAAGTAAAAATCAATAAAGG - Intergenic
921931806 1:220760858-220760880 AAAAATGTTTAAATGGATAATGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922689757 1:227678861-227678883 AAGAATGTGAAAATGGAAAATGG + Intergenic
922745730 1:228042528-228042550 ATGAATGTACAGATGATGAAGGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924429033 1:243980637-243980659 ATGAATGGATTAATGGTTAATGG + Intergenic
924668903 1:246103128-246103150 AAGAATGAACAAATGAATATAGG + Intronic
924820815 1:247488659-247488681 AGCAATGGACAAATGGATAATGG - Intergenic
1062921745 10:1285458-1285480 ATGAATGCACAAATGGGCACCGG + Intronic
1063032668 10:2251327-2251349 AAGAAAGAACAAATGGATCAAGG - Intergenic
1063500447 10:6548966-6548988 ATGAATGGATAAATGGATCATGG - Intronic
1063707791 10:8447707-8447729 ATCTATGGATAAATGGATAAAGG + Intergenic
1065658671 10:27981784-27981806 ATGAATGAACAATTGAATGAAGG - Intronic
1066398700 10:35052549-35052571 ATGAATGAATAAATGAATAGTGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067709803 10:48638775-48638797 CTTAATGAACAAAGGGATAATGG + Intronic
1067730516 10:48807207-48807229 GGGAATGAACAAATGGGTAATGG + Intronic
1068113909 10:52714996-52715018 ATGAAAGTACACAATGATAATGG + Intergenic
1068129643 10:52881630-52881652 ATGAATGAACAAATGGGTACAGG + Intergenic
1068204676 10:53834868-53834890 ATGAATGTAGAAATAAGTAAAGG + Intronic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069887494 10:71633363-71633385 GTGAATGGACGAAGGGATAAAGG - Intronic
1070448466 10:76532394-76532416 ATGAATAAATAAATGTATAAAGG - Intronic
1070466585 10:76730170-76730192 ATTAATATGCAAATGTATAATGG - Intergenic
1071060507 10:81564944-81564966 ATCAATGGATGAATGGATAATGG + Intergenic
1071238073 10:83672695-83672717 AGGAATGGAGAAATAGATAAAGG + Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1071768459 10:88697202-88697224 AAGGATGTACAAATGAATCATGG + Intergenic
1072691565 10:97575401-97575423 ATGAATGATCGAATGGATGATGG - Intronic
1072829489 10:98642528-98642550 ATGAATGTACAAAGGTGGAAGGG + Intronic
1073796188 10:106990716-106990738 ATGCAGGTAGAAATGGAAAATGG - Intronic
1073807832 10:107118678-107118700 AAGGAAGTAGAAATGGATAAGGG - Intronic
1074066568 10:110020166-110020188 TTGAATGAATAAATGAATAAAGG - Intronic
1074950516 10:118329810-118329832 ATGAATGCAAACATGGATGACGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075480087 10:122772819-122772841 ATCAATGGATGAATGGATAAAGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1077280561 11:1743180-1743202 AAGAATGGACAAATGGAAGATGG + Intronic
1077280566 11:1743218-1743240 AAGAATGGACAAATGGAAGATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1077481951 11:2819094-2819116 ATGAATGAACCAATGAACAAAGG - Intronic
1078161840 11:8846811-8846833 ATCAAAATACAAATGGATCATGG - Intronic
1078326103 11:10382341-10382363 ATAAATTTTCAAATGGATTACGG + Intronic
1079554102 11:21738411-21738433 ATGAATGAATAAATGAATGATGG + Intergenic
1079663840 11:23078261-23078283 TTGAAAGTAAAAATGGAGAAAGG + Intergenic
1080023747 11:27592250-27592272 GTGAATGTACAAGGGGGTAATGG + Intergenic
1080117295 11:28635254-28635276 CTGAATGAATAAATGAATAAAGG - Intergenic
1080609241 11:33889527-33889549 ATGAATGAACAAATGAGTGAAGG - Intronic
1081006570 11:37751612-37751634 ATAAACAGACAAATGGATAAAGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081223322 11:40489867-40489889 TTAAATGAATAAATGGATAAAGG - Intronic
1081234239 11:40626702-40626724 ATGTATGTAGATTTGGATAATGG - Intronic
1081538299 11:44011581-44011603 GTGAATGAATAAATGAATAAAGG + Intergenic
1082111040 11:48274365-48274387 ATCAATGAATGAATGGATAAAGG - Intergenic
1082204134 11:49411032-49411054 ATGAAGATACAAAGGGATCATGG + Intergenic
1082219374 11:49615026-49615048 ATGTATGTACACATGTATATGGG - Intergenic
1082647141 11:55741122-55741144 TTGAATGAACTAATGGATCAAGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1083090587 11:60195322-60195344 AGGAATATACTAATGGAGAAAGG - Intergenic
1084445084 11:69198955-69198977 ATAAATGGATAAATGAATAAAGG - Intergenic
1085528619 11:77178523-77178545 CTGAATGTAGAAATAAATAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086752598 11:90516355-90516377 ATGAACTTACAAATAAATAAAGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087157646 11:94920588-94920610 AGGAATGTACAAATGCTTGAAGG + Intergenic
1087813394 11:102632547-102632569 ATCAATGGATGAATGGATAAAGG + Intergenic
1087910856 11:103751853-103751875 ATGAATGAATACATGAATAATGG - Intergenic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1089811925 11:121139225-121139247 ATGAATGTAATAATGGCTACTGG - Intronic
1090880244 11:130826444-130826466 ATGAATGAATAAAGGGATGAAGG - Intergenic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1091782257 12:3221203-3221225 TTGAATGAATAAATGAATAAGGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094349793 12:29511436-29511458 ATGAATGAATAAATGAATGATGG + Intronic
1094754071 12:33445863-33445885 GTGAATGGAGAAATAGATAAAGG - Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095631520 12:44382214-44382236 ATGTATGTACAAATGAAGACAGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097502612 12:60424559-60424581 ATAAATCTACTAATGGATGAGGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1098168329 12:67720084-67720106 ATGAATGTGTAAATGGAAATAGG + Intergenic
1098484380 12:71003893-71003915 TTGAATGTACAAAGGCAAAATGG + Intergenic
1098643283 12:72865195-72865217 ATGAATGAATAAATGGCTATTGG - Intergenic
1098711946 12:73773952-73773974 ATGAATGTAGAACTGAATAAGGG + Intergenic
1099666523 12:85637101-85637123 ATGAATCCACAAGTGAATAAAGG - Intergenic
1100116155 12:91307018-91307040 ATGAATGAAAAAATTGGTAAAGG + Intergenic
1100267803 12:92994736-92994758 ATATATATACAAAGGGATAAAGG - Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100793064 12:98152047-98152069 ATGAATGTATACAGGAATAAAGG + Intergenic
1100866024 12:98857655-98857677 ATGAATGAATAAATGAATGAAGG + Intronic
1101677586 12:106932273-106932295 ATTAAGTTAAAAATGGATAAAGG + Intergenic
1102222956 12:111206947-111206969 ATGAATGCATAAATGGATGGTGG + Intronic
1102222969 12:111207042-111207064 ATGAATGGATAAATGGATGGTGG + Intronic
1102664555 12:114559840-114559862 AAGAATGAGCAAATTGATAATGG - Intergenic
1102738432 12:115184063-115184085 ATCAATGAACAAATGGATAAAGG + Intergenic
1103745154 12:123117729-123117751 ATGAATGAACAAATCCATGAAGG - Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104114874 12:125739675-125739697 AAGAATCTACAAATGTAGAATGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105279768 13:18956596-18956618 ATGAATGAACAAATGGTGAGTGG - Intergenic
1105555589 13:21445230-21445252 TTTAATGGACAAATGTATAATGG + Intronic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106273319 13:28176100-28176122 ATGGTAGTACAAATGGAGAAAGG + Intronic
1106639548 13:31569088-31569110 ATGCATGTACACAGGGAAAAGGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107122149 13:36807685-36807707 ATGAAAGTATAATTGGACAAAGG + Intergenic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1108020123 13:46119860-46119882 TTGTATGTACAAATAGAGAATGG + Intergenic
1108158167 13:47609896-47609918 ATCAATGGATAAATGGATAAAGG + Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108979089 13:56487727-56487749 AATACTTTACAAATGGATAATGG - Intergenic
1109664253 13:65509939-65509961 ATCAATGAATGAATGGATAAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109967678 13:69722926-69722948 AACAATGGATAAATGGATAATGG + Intronic
1110152727 13:72274423-72274445 ATGACTATATAAATGTATAAAGG + Intergenic
1110373334 13:74764134-74764156 TTGAATGAATAAATGTATAAGGG - Intergenic
1110457063 13:75700995-75701017 ATGAATGAACAAATAGAACATGG - Intronic
1110493578 13:76137962-76137984 ATCAATGTATGACTGGATAAAGG - Intergenic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1110589165 13:77234459-77234481 TTAAATGTACAAGTGGGTAAAGG + Intronic
1110605244 13:77424861-77424883 ATCAATGGACAAATAGATATAGG - Intergenic
1111095482 13:83508887-83508909 ATGAATGAACAAATGCATTGGGG + Intergenic
1111447002 13:88359597-88359619 ATCAATGGATAAATGGATAAAGG + Intergenic
1112762630 13:102708499-102708521 ATGAATGTACGAATGAACACTGG + Intergenic
1112936414 13:104805275-104805297 ATGAATATAGAAATGGAAATTGG - Intergenic
1113653023 13:112050639-112050661 ATGAATGAAGAAATGAATGAAGG + Intergenic
1113901113 13:113798649-113798671 ATGAATGGAAGGATGGATAATGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114851047 14:26382856-26382878 ATGAATGTTAAAAAGGATGATGG + Intergenic
1114859953 14:26504885-26504907 ATGTGTGTACAAAGGGAAAAGGG + Intronic
1114939132 14:27584554-27584576 ATGAATTTAATAATGGATGATGG + Intergenic
1115049635 14:29042066-29042088 ATGGATGAATAAATGAATAAAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115189227 14:30729060-30729082 AAAAATGGACAAATGGACAAAGG - Intronic
1115483161 14:33882594-33882616 AAGAAAGTAAAACTGGATAAAGG - Intergenic
1116648259 14:47557847-47557869 TTGAATGTACAAATTAATAAAGG - Intronic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1118078923 14:62335670-62335692 ATGGATGTATAATTTGATAATGG + Intergenic
1119170733 14:72534580-72534602 ATGAATAGATAAATGGGTAAAGG - Intronic
1119908329 14:78325759-78325781 ATGTTTGTACAAATGGAAACAGG - Intronic
1120091532 14:80337783-80337805 ATGTATGTACAGATTGGTAAAGG - Intronic
1120489577 14:85160299-85160321 ATGAATTAACAAATGGAAGAAGG - Intergenic
1120600417 14:86498127-86498149 ATGAATGGACAAATGAATTATGG + Intergenic
1120656256 14:87193608-87193630 ATGGATGGATGAATGGATAATGG + Intergenic
1120795889 14:88632491-88632513 ATGAATGTAGAGAGGGATAGTGG - Intronic
1121393941 14:93601486-93601508 ATTAATCAACAAGTGGATAAAGG - Intronic
1121416322 14:93781585-93781607 ATGAAGGCACAGATGTATAAGGG + Intronic
1121687786 14:95851673-95851695 ATTGATGGATAAATGGATAAAGG + Intergenic
1122877508 14:104675641-104675663 ATGGATGGACAGATGGATAATGG + Intergenic
1123103736 14:105825693-105825715 ATCAATCAACAAGTGGATAAAGG - Intergenic
1123755573 15:23395283-23395305 AGGAATGAGCAAATGGAAAAGGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124711146 15:32013255-32013277 ATGAAGAGACAAGTGGATAAAGG - Intergenic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1126418541 15:48445476-48445498 ATGAATGTGCAAGTGGAAATGGG - Exonic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1127215491 15:56819277-56819299 GTGAAAGTACAAATGAATTAGGG - Intronic
1127379931 15:58422153-58422175 ATGAAGGTACAAATGGCAAATGG - Intronic
1127407258 15:58663622-58663644 TTGAATCTACAAATCAATAAAGG + Intronic
1127620589 15:60729999-60730021 ATAAATGTAAAAAGGGACAAGGG - Intronic
1127626474 15:60785116-60785138 ATGAATGTACAAGTGGGTACAGG - Intronic
1128213534 15:65918250-65918272 ATTTATGTGCAAATGGAGAAGGG - Intronic
1128251455 15:66166865-66166887 ATAAAAGTACAAGTGAATAAAGG + Intronic
1128776594 15:70324964-70324986 AAGAAAGTACAAACGGAGAAGGG + Intergenic
1129134908 15:73539582-73539604 GTGAGGGTTCAAATGGATAAGGG + Intronic
1130533215 15:84763659-84763681 ATTAATGTAAAAATGTAGAAGGG - Intronic
1131068944 15:89452177-89452199 ATGCATGTATAAATGTATCATGG - Intergenic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1131946960 15:97632804-97632826 ATCAATCTACAAATGCATATGGG + Intergenic
1132319062 15:100911491-100911513 ATGAATGAGCAAATGAATGATGG - Intronic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133617216 16:7488703-7488725 ATGAATGTATAGCTAGATAAGGG - Intronic
1133617225 16:7488842-7488864 ATGAATGTATAGATAGATAATGG - Intronic
1133617230 16:7488944-7488966 ATGAATGTATACATAGATAGTGG - Intronic
1134231180 16:12431848-12431870 ATGAAAGAACAAATGAATGAAGG - Intronic
1134315366 16:13113926-13113948 ATGAATGAACAAATGAATAATGG - Intronic
1134460803 16:14427742-14427764 AGGAATGAGCAAATGGAAAAGGG + Intergenic
1134632236 16:15765157-15765179 ATGAATGAATAAATGGATAGAGG + Intronic
1134632514 16:15767090-15767112 ATGAATGTATAAATGTATAGAGG + Intronic
1135528843 16:23235087-23235109 ATTGATGTAAAAATGGATAAGGG - Intergenic
1136071373 16:27789544-27789566 ATAAATGAAGAAATGCATAATGG + Exonic
1136071468 16:27790214-27790236 ATGAATGGATGGATGGATAATGG + Exonic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137264904 16:46860689-46860711 ATTTTTGTACAAATGGAGAATGG + Intergenic
1137516777 16:49151744-49151766 ATGAAATTACAAATGAAAAAAGG + Intergenic
1138350356 16:56343146-56343168 ATGCATGTATAAAAGGAAAATGG + Intronic
1138512367 16:57516041-57516063 ATGGATGAACCAATGGGTAAAGG - Intronic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138733130 16:59218122-59218144 ATTTATGTAGAAATGCATAAAGG - Intergenic
1138949692 16:61897215-61897237 ATGTATTTACAAGTGCATAAAGG + Intronic
1139103489 16:63798371-63798393 ATCAATGGGCAATTGGATAAAGG + Intergenic
1139218774 16:65157381-65157403 ATGAATGAATGAATGTATAAGGG + Intergenic
1139799775 16:69512945-69512967 ATGAATTGATAAATGGATATAGG + Intergenic
1140453763 16:75092589-75092611 TTGTATGGACAAATGGATCAGGG + Intronic
1140917139 16:79504591-79504613 ATGGATGGATAAATGGATAGAGG + Intergenic
1141134446 16:81456544-81456566 ATGAATGTACATCTGCACAAAGG - Intronic
1141327363 16:83074380-83074402 ATCAGTGGATAAATGGATAACGG - Intronic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141854770 16:86673574-86673596 GTGAATGGACAAATGGATCAAGG - Intergenic
1203142273 16_KI270728v1_random:1775896-1775918 ATGAATGGATGAATGGATAAAGG - Intergenic
1142678483 17:1530966-1530988 TTGAAAGTCCAAATGGAGAACGG + Intronic
1143533155 17:7517967-7517989 ATGAATGAAAAAATGGAGAGAGG - Intergenic
1143742154 17:8962311-8962333 ATGAATGTACAAAAAGACACAGG + Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1144420208 17:15090348-15090370 AGAAATGGATAAATGGATAAAGG + Intergenic
1145005925 17:19337751-19337773 ATGAAGGGAAAAATGGACAAGGG + Intronic
1146817806 17:35957729-35957751 AAGAATACACAAATGGATTAAGG - Intergenic
1147404002 17:40197709-40197731 ATGAATGGACAAATGCATTGGGG + Intergenic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1148236049 17:45969896-45969918 ATGTATGATCAAATGGATAATGG - Intronic
1148317858 17:46719677-46719699 ATTGATGCAAAAATGGATAAAGG - Intronic
1148979043 17:51555285-51555307 AAGAATGTAGAAAGGGAGAAAGG - Intergenic
1149382787 17:56110596-56110618 ATGAATGAACAAATGAGTGAAGG + Intergenic
1150848128 17:68679939-68679961 GTGGATGGACAAATGGGTAATGG - Intergenic
1150984622 17:70181923-70181945 ATAAATGCATAAATGAATAAAGG + Intergenic
1151353377 17:73544599-73544621 ATACATGGACAGATGGATAATGG + Intronic
1152031137 17:77844092-77844114 ATGAATGGACAAATGAATTTTGG + Intergenic
1152314060 17:79569854-79569876 AGGAATGGACAGATGGATTATGG + Intergenic
1152314090 17:79570076-79570098 AGGAATGGACAGATGGATTATGG + Intergenic
1152314119 17:79570294-79570316 AGGAATGGACAGATGGATTATGG + Intergenic
1153065924 18:1045093-1045115 ATCAATGAACGAGTGGATAAAGG + Intergenic
1153466072 18:5389180-5389202 ATGAATGAACACATTGATAAAGG - Intergenic
1153536889 18:6111198-6111220 AGGAAGATGCAAATGGATAAGGG + Intronic
1153617854 18:6951099-6951121 ATGGATGTGTAAATGGATGAAGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1156119345 18:33822920-33822942 ATGAATGTAAGAATGGATACTGG - Intergenic
1156821358 18:41376845-41376867 ATGAATGTAAACAGGGAGAATGG + Intergenic
1156973614 18:43189275-43189297 ATGAATGTAAAAAAGTACAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158430449 18:57380754-57380776 ATGAAAGAACAAATGGGTAATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158975876 18:62711386-62711408 TTGAAAGAACAAATTGATAAAGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159872625 18:73775662-73775684 TTGAATGTACAAATGAATTTGGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1161090418 19:2357377-2357399 ATGGATGGACAAATGGATGGTGG - Intergenic
1161785082 19:6319498-6319520 ATGAATGAACGAATGAATGAAGG - Intronic
1161934503 19:7363323-7363345 GTGAATGGATAAATGGATGATGG + Intronic
1161999404 19:7733673-7733695 TTAAATGAAAAAATGGATAAGGG - Intronic
1162059974 19:8088563-8088585 ATGAATGGTTAAATGAATAAGGG + Intronic
1162362779 19:10229991-10230013 ATGAATGAACCAATGAACAAAGG + Intronic
1162424746 19:10587715-10587737 ATGGATGGATGAATGGATAATGG - Intergenic
1162507640 19:11095977-11095999 ATCAAAGTTGAAATGGATAAAGG + Intronic
1163534834 19:17871228-17871250 ATGAAGTGACAAATGAATAAAGG + Intergenic
1164516357 19:28939594-28939616 ATCAATCAACAAGTGGATAAAGG + Intergenic
1164811692 19:31162472-31162494 ATGAATGAGTAAATGGATGACGG + Intergenic
1165602880 19:37072969-37072991 ATGACTGTACAAATATTTAATGG + Intronic
1165988238 19:39789456-39789478 ATCAATCAACAAGTGGATAAAGG + Intergenic
1167077605 19:47258813-47258835 ATGAATGAATGAATGAATAATGG - Intronic
1168330970 19:55568324-55568346 GTGAATGGATGAATGGATAATGG + Intergenic
1168508251 19:56954494-56954516 ATGGATGGATGAATGGATAATGG - Intergenic
924997718 2:378787-378809 ATGAAACTAGAAATAGATAATGG + Intergenic
925841071 2:7992882-7992904 CTGGATGTACAAGTGAATAAAGG + Intergenic
925925624 2:8668101-8668123 ATGGATGGAAAAATGGATGAAGG + Intergenic
925925634 2:8668156-8668178 AGGAATGGACATATGGATAAAGG + Intergenic
926057675 2:9784702-9784724 ATAAAAGTACTAATGGATACTGG + Intergenic
926378465 2:12259868-12259890 ATGAATGAATAAATGAATGAGGG + Intergenic
926507204 2:13731903-13731925 ATTAATGTAGAAATGGTCAATGG - Intergenic
926887086 2:17607747-17607769 ATAAATTAACAAATGAATAAAGG + Intronic
927462472 2:23310869-23310891 ATGACTGAACAAATGAATAAGGG + Intergenic
928059588 2:28097457-28097479 AAAAATGTACAACTTGATAAAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929836324 2:45403969-45403991 AAGAATGTAAAAATGAATAGAGG + Intronic
929860320 2:45671471-45671493 TTAAATGCATAAATGGATAATGG - Intronic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931596036 2:63944717-63944739 TTTAATGTACAAATGGAACATGG - Intronic
931819680 2:65938773-65938795 ATGAATGGAAAAGTGGAGAAGGG + Intergenic
931842741 2:66171470-66171492 ATGAATTTAATAATGCATAATGG + Intergenic
932011870 2:67986574-67986596 ATGAATGTGCAAGTTGAGAAGGG - Intergenic
932397281 2:71456631-71456653 ATGAATGTATACATGCACAAAGG - Intronic
932652001 2:73567932-73567954 ATCAATTTATAAATGAATAATGG + Intronic
932672848 2:73753302-73753324 AAGATTGTAGAAAGGGATAATGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933074177 2:77902485-77902507 ATGAAACTTCAAATGAATAAGGG + Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933296807 2:80500325-80500347 ATGAATGAATAAATGGATGGTGG - Intronic
933486522 2:82931691-82931713 ATGTATGTATAAATGCAAAATGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935247147 2:101228769-101228791 AAGATTGTACAAATGTATATAGG + Intronic
935610284 2:105016109-105016131 ATGAGTGTCTAGATGGATAAAGG + Intergenic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
935733522 2:106086332-106086354 ATGAAAATACATATGGGTAAAGG - Intergenic
935758734 2:106298814-106298836 ATAAATGTATAAATGAATGAAGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
936466120 2:112752610-112752632 AACAATTTACAAATGGGTAATGG + Intronic
936769638 2:115895578-115895600 ATGAATCTACAAATTGATATCGG + Intergenic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938737592 2:134200587-134200609 ATGAGTGAATAAATGGAGAAAGG - Intronic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939164499 2:138626102-138626124 GTGAATGTAAGAATGGAGAAGGG - Intergenic
939283274 2:140093054-140093076 AGGAATGCAAATATGGATAAGGG + Intergenic
939310776 2:140472228-140472250 ATGAATGAATAAATGAATGATGG + Intronic
939411589 2:141833777-141833799 AAGTATGTACAAAAGGCTAAAGG + Intronic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
939900093 2:147841325-147841347 AAGAATGTGGGAATGGATAAGGG - Intergenic
940075974 2:149742806-149742828 ATGAAAGGACAAATGGCAAAAGG + Intergenic
941385908 2:164851739-164851761 ATTGATGGATAAATGGATAAAGG - Intergenic
941503796 2:166314566-166314588 ACCAATGAATAAATGGATAAAGG + Intronic
941599675 2:167526285-167526307 TAGAATGTACTACTGGATAAGGG - Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942768284 2:179483668-179483690 ATGAGTGGACAAAAGGATTAGGG + Intronic
943826176 2:192396415-192396437 ATGATAGTACAAAGGAATAAAGG - Intergenic
944935286 2:204561299-204561321 ATGAAAGTATAAATTGATATGGG + Intronic
945300626 2:208212966-208212988 GTCAATGTCCTAATGGATAAGGG + Intergenic
945399977 2:209369686-209369708 CTTAATGTAGAAATGGATAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945901389 2:215541544-215541566 ATGAATTAACATATTGATAATGG - Intergenic
945936395 2:215906821-215906843 ATGACAGTAAAAATGGAAAATGG + Intergenic
946083960 2:217152172-217152194 AAGAATGGACAAATGGATGCTGG + Intergenic
947062638 2:226183559-226183581 CTGAATGAATAAATGAATAACGG + Intergenic
947153552 2:227137853-227137875 AAGATTGTACAAATGCAAAAAGG - Intronic
947938816 2:234030745-234030767 ATGAATAAATAAATGCATAAAGG - Intergenic
1168865712 20:1084717-1084739 ATGAATGAATAAATGAATGATGG + Intergenic
1168919493 20:1519390-1519412 ATGTATGTTTAAATGGATCATGG + Intergenic
1169026043 20:2372311-2372333 ATGCATTTATAAAAGGATAAAGG + Intergenic
1169477848 20:5948713-5948735 AAGAATTTAAAAATGGTTAAAGG + Intronic
1169657524 20:7941863-7941885 ATTAAGAGACAAATGGATAAGGG - Intergenic
1170011060 20:11724483-11724505 AGGAATGCAAATATGGATAATGG - Intergenic
1170757744 20:19219373-19219395 TTGAATGAACAAATGGGTGAAGG - Intronic
1171320865 20:24242869-24242891 ATGAGGGGACAAATGGATACAGG - Intergenic
1171576669 20:26333186-26333208 TTGAATTTACAAGTGGATATTGG + Intergenic
1172051854 20:32123643-32123665 ATGTATATATAAATGTATAAGGG - Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1172741668 20:37173262-37173284 ATGAATGTATGAATGAATGAAGG + Intronic
1172747818 20:37226528-37226550 ATGTATGTATAAATAAATAAGGG + Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1172978777 20:38925961-38925983 ATGAATGAATACATGGTTAAAGG + Intergenic
1173015062 20:39217684-39217706 ATAAATTTAAAAATGGATAAAGG - Intergenic
1173039399 20:39447005-39447027 AAGGATGTACAAATTGATATGGG - Intergenic
1173057691 20:39632049-39632071 ATTAATGAACAAATGAATGAAGG - Intergenic
1173871520 20:46344999-46345021 ATGGATGGAGAGATGGATAATGG - Intergenic
1173951056 20:46993532-46993554 ATGAATGAACAAATGAATGAAGG - Intronic
1175086500 20:56463861-56463883 ATGAATGAACGAAAGGAAAAGGG - Intergenic
1175221195 20:57417466-57417488 ATGAATGGAGAAACGGATAGAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175817351 20:61890245-61890267 ATGGATGCATAGATGGATAATGG + Intronic
1175817369 20:61890345-61890367 ATGTATGGATAGATGGATAATGG + Intronic
1175817390 20:61890444-61890466 ATGGATGGATAAATGGATGATGG + Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177088549 21:16737741-16737763 ATGAAAGTAGAAATAAATAAGGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177888515 21:26776279-26776301 ATGAATGTAATAGTGGAAAATGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180025117 21:45156428-45156450 ATGGATGGACGAATGGATGATGG - Intronic
1181363986 22:22359719-22359741 ATAAACCAACAAATGGATAAAGG - Intergenic
1181958979 22:26609466-26609488 ATGAATGGATGCATGGATAAAGG + Intronic
1182047390 22:27285991-27286013 ATGAATGGATGAATGGATGATGG + Intergenic
1182647783 22:31824412-31824434 ATGAACCTACCAATGAATAAAGG - Intronic
1182954415 22:34407935-34407957 ATGAATGGACAAATGAGTATTGG - Intergenic
1184659055 22:45957232-45957254 ATGTATGTAAAAATGCATCAAGG + Intronic
1184996753 22:48212786-48212808 ATGAATGGATGAATGGATGATGG - Intergenic
1184996781 22:48213024-48213046 ATGAATGGATTAATGGATGATGG - Intergenic
1185104360 22:48858915-48858937 ATGAATGGATGAATGGATGATGG - Intergenic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
950175697 3:10872726-10872748 ATGAATGAACAAATGGGTGGAGG + Intronic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
951798695 3:26571146-26571168 ATGAATGGATGAATGGATAAAGG - Intergenic
951921858 3:27863663-27863685 ATCAACATATAAATGGATAAAGG - Intergenic
951976257 3:28513234-28513256 ATTAATGTAAAAATGTATACAGG - Intronic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
952107870 3:30090274-30090296 TTGAATGTAAAATTGAATAAGGG + Intergenic
952857643 3:37785315-37785337 ATGATTGTCCAAAGGGAAAATGG + Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953443441 3:42940786-42940808 ATGAAAGTAGAATTGGAAAATGG + Intronic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
954623675 3:52010403-52010425 ATGGATGGACAGATGGATAGAGG - Intergenic
954818318 3:53302208-53302230 ATCAATGGGCAAATGGGTAATGG + Intronic
954954869 3:54510234-54510256 ATGAATGGATGAATGGATGAAGG + Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
955215580 3:56982698-56982720 ATGAATGAGGAAATGGATGATGG + Intronic
955216874 3:56991265-56991287 ATGAATGAGCAAATGGGGAAAGG - Intronic
955333152 3:58064038-58064060 ATGACTCTACAAAGAGATAATGG - Intronic
955379810 3:58428752-58428774 ATGAATGTACAAACTGTAAAAGG + Intronic
955443665 3:58984059-58984081 ATTAATGTTTAAATGGAAAAGGG + Intronic
955875289 3:63482805-63482827 ATGAATATGTACATGGATAATGG - Intronic
955877996 3:63513766-63513788 ATGAATGTACAAATGATGGAAGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956612188 3:71135349-71135371 TTACATGTACAAATGGATATTGG - Intronic
956809519 3:72850855-72850877 ATGGATGTAGAAATAGAAAAGGG - Intronic
956819257 3:72938225-72938247 ATGGATGTATAGATGGATAGGGG + Intronic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957642671 3:82877234-82877256 ATGACTGAATAAATGGCTAAAGG + Intergenic
957795915 3:85006913-85006935 ATCAATGCACGAATGTATAATGG - Intronic
959177141 3:102927737-102927759 ATGTATGTACAAAATGTTAATGG - Intergenic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959741251 3:109722685-109722707 ATGAACCTAGAAATGAATAAGGG - Intergenic
960269623 3:115659487-115659509 ATGAATGAACAAATGCATGCTGG - Intronic
960352776 3:116613209-116613231 ATGAATGCATGAATGGGTAAAGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
962261637 3:133912905-133912927 ATGAATGTATAAATGGTGGATGG + Intergenic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
963059815 3:141216309-141216331 ATGAATGAATGAATGGATGATGG + Intergenic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963565753 3:146928206-146928228 CTGAATGAATAAATGAATAAAGG - Intergenic
964371658 3:156006391-156006413 ATGAATGAACCAATGAAGAAAGG + Intergenic
964757855 3:160104999-160105021 AGGAATGTCCATATGGATCATGG + Intergenic
965129699 3:164681264-164681286 ATGAATGTATGGATGAATAAAGG + Intergenic
965222652 3:165946996-165947018 TAGAATGTACAAATGAATGATGG - Intergenic
965315568 3:167185821-167185843 ATTAATGTACATATGGAAAATGG - Intergenic
965482491 3:169236432-169236454 ATGAATACATAAATGAATAAGGG + Intronic
966179211 3:177172415-177172437 ATGCATGTAAAAAGGAATAAGGG + Intronic
966699740 3:182834808-182834830 ATGAATTTTCAATTGCATAAGGG - Intronic
967410444 3:189161611-189161633 AAGAGTGAAAAAATGGATAAAGG - Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968189035 3:196654090-196654112 ATGAATGAACAACTGGAGAGTGG - Intronic
968946136 4:3665478-3665500 ATGAATGGATGAATGGATAGAGG - Intergenic
969571570 4:8012025-8012047 ATGAATGGACAGATAGTTAAAGG - Intronic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970083818 4:12322319-12322341 CAGAATGTATTAATGGATAATGG + Intergenic
970326614 4:14931465-14931487 AGGAATGCAAAAATGTATAATGG - Intergenic
970774440 4:19656073-19656095 AAGATTTTTCAAATGGATAATGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971481818 4:27121647-27121669 AAGAAAGTAAAAATGCATAAAGG - Intergenic
971682032 4:29712401-29712423 TTCAGTGGACAAATGGATAAAGG - Intergenic
971993063 4:33926987-33927009 ATGAATGTATGAATTAATAAAGG - Intergenic
972058102 4:34829242-34829264 ATGAATGAATAAATTAATAATGG - Intergenic
972214106 4:36875534-36875556 ATGAATGAATAAATGAATAGAGG + Intergenic
972752487 4:42005798-42005820 ATTAATGAATAAATGAATAAAGG - Intronic
973291706 4:48477522-48477544 ATGAATGTCAAAATGGAGGAGGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974618132 4:64316966-64316988 ATATATGTACAAATTGAAAAAGG + Intronic
975517766 4:75265925-75265947 ATTAATCAACAAGTGGATAAAGG + Intergenic
976256415 4:83105255-83105277 ATCAATGAACAAATGAATGAAGG - Intronic
976335616 4:83882136-83882158 ATGTATGTACATATGAATACAGG + Intergenic
976397038 4:84567178-84567200 ATCAATGGATGAATGGATAAAGG + Intergenic
976781462 4:88763264-88763286 ATGAATGAACGAATGGGAAAGGG - Intronic
977484772 4:97629039-97629061 ATGCATATACAAATGAATATGGG - Intronic
978260699 4:106754031-106754053 ATCAATTATCAAATGGATAAGGG + Intergenic
978783964 4:112588423-112588445 ATGAGTGTAAAAATATATAAAGG - Intronic
979427981 4:120591614-120591636 GTGAATGAACAAATGGATACAGG + Intergenic
979802670 4:124930278-124930300 ATAAATGTATAAATGTTTAATGG + Intergenic
979977994 4:127220574-127220596 ATTGATGGACAAATGGATATAGG - Intergenic
980332574 4:131428429-131428451 ATAAATGTATAAATGGCCAAGGG - Intergenic
980333562 4:131440590-131440612 TGGAAAGTCCAAATGGATAAGGG - Intergenic
980523344 4:133959127-133959149 ATGAATGAACAAATGTATTTTGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982494728 4:156076758-156076780 AAGAATAGACAAATAGATAAAGG - Intergenic
982587820 4:157264850-157264872 ATTTATGAACAAATGGCTAAAGG - Intronic
983249965 4:165332138-165332160 AAAAATGTACATATGGATAAAGG - Intronic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984041083 4:174734551-174734573 ATAATTGTACATATGGATAATGG - Intronic
984317890 4:178151333-178151355 ATAAATGAACAAATGAATAGAGG - Intergenic
984435051 4:179699157-179699179 TTGCATGTTCATATGGATAAGGG + Intergenic
984674341 4:182529672-182529694 ATAAATGAACAAATGAATGAAGG - Intronic
984958592 4:185071493-185071515 ATGAATGTGGAAATGTAGAATGG + Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987162553 5:15159205-15159227 ATGAATGTATAAATGAATTAGGG - Intergenic
987729489 5:21750008-21750030 ATGTATTTATAAATGAATAACGG + Intergenic
987946884 5:24621290-24621312 ATGAATAAATAAATGGATATGGG - Intronic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988114424 5:26866576-26866598 AAGCATGTACAAATAGATGAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988715116 5:33818463-33818485 ATAAACAGACAAATGGATAAAGG - Intronic
988865929 5:35335050-35335072 ATGAATGAACCAATGAATGAAGG - Intergenic
989321493 5:40139934-40139956 ATGAATGTACAGATGAGTAGAGG + Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991250342 5:64553484-64553506 AAGAATGTAGAAAAGAATAAAGG - Intronic
991552252 5:67851945-67851967 ATGATTTTGTAAATGGATAAAGG + Intergenic
991693135 5:69245103-69245125 ATGAATGTACATCAGGATATTGG + Intronic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
992935880 5:81704407-81704429 TTGAATGTACATATGCATACAGG + Intronic
993610608 5:90049673-90049695 ATAAATGTCCAAATGCATAATGG - Intergenic
994012901 5:94928173-94928195 ATGAATTTACCAATGGGTAAAGG - Intronic
994588661 5:101745546-101745568 ATCAGTGGATAAATGGATAAAGG - Intergenic
994908340 5:105868912-105868934 ATGAATCTACATGGGGATAAGGG + Intergenic
995173617 5:109147062-109147084 CTGAATGGAAAAATGGGTAAAGG + Intronic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995806873 5:116063215-116063237 ATGAATGAATAAATGAATAATGG - Intergenic
996041622 5:118820270-118820292 ATGAATGTAAAAATGTTGAAGGG - Intergenic
996117466 5:119634139-119634161 ATGCAGGTACAAATGAACAAAGG + Exonic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997869481 5:137494808-137494830 ATGAAGGTACAAATGAACAGAGG + Intronic
998578237 5:143341183-143341205 AAGAATGAACAATAGGATAATGG + Intronic
998602586 5:143600272-143600294 TTGAATGAATAAATGGATTAAGG + Intergenic
998769160 5:145522246-145522268 ATGCATGTAAAAATGCAAAAGGG - Intronic
998822910 5:146073000-146073022 ATGAATGTAAATAATGATAATGG - Intronic
999204362 5:149837378-149837400 CAAAAAGTACAAATGGATAAGGG - Intronic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999854503 5:155579525-155579547 ATGAATGCATGAATGGATGATGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000901958 5:166921903-166921925 ATGAATGAACAAATGAATGAAGG + Intergenic
1001386856 5:171346818-171346840 ATTTATTTACAAATGGGTAAAGG - Intergenic
1001487444 5:172129540-172129562 ATGAATGAACAAGTGGATGGAGG - Intronic
1001661183 5:173394749-173394771 ATTAATGTTCTATTGGATAAAGG - Intergenic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1001872867 5:175171882-175171904 ATGGATGAATAAATTGATAATGG - Intergenic
1001899772 5:175416890-175416912 ATCAATGAACAAATGGATCGTGG - Intergenic
1003171316 6:3723964-3723986 ATGAATGAAGGAATGGATGAAGG - Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004794947 6:19071004-19071026 ATTAATATATAAATGGAGAAAGG + Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1005447028 6:25934452-25934474 ATTAAAGTACAAAGGTATAAAGG + Intergenic
1005536494 6:26762415-26762437 ATGCATGTACACATGCACAAAGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005658772 6:27971610-27971632 ATCAATGGATGAATGGATAAAGG + Intergenic
1006743521 6:36325592-36325614 ATGGAAGCACAAAGGGATAAGGG - Intronic
1007792873 6:44322815-44322837 ATGAATGGATAAATGGAAAGTGG + Intronic
1008362645 6:50639677-50639699 ATAAATGTATAAATGTATATGGG + Intergenic
1008419276 6:51278305-51278327 ATGAATAAACAAAAGCATAAAGG - Intergenic
1008463222 6:51800179-51800201 ATGGATGAACAAGTGGTTAAAGG - Intronic
1008624215 6:53301694-53301716 ATGACAGTAAAAATGGATTACGG + Intronic
1008752517 6:54753688-54753710 ATTAATGAAGAAATTGATAACGG - Intergenic
1008786791 6:55177589-55177611 ATGAAAGTACAAATGGTGACTGG - Intronic
1008832609 6:55785184-55785206 ATGAAAGAACAAATTGATATTGG + Intronic
1008835515 6:55822545-55822567 ATTAATGAAAAAATGAATAATGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009007393 6:57804553-57804575 ATGAATGTGCAAATGCATGTGGG - Intergenic
1009059188 6:58376756-58376778 ATGAATGGCCAAATGGAATATGG + Intergenic
1009231656 6:61070372-61070394 ATGAATGGCCAAATGGAATATGG - Intergenic
1009327331 6:62369290-62369312 AAGAATGTTCAACTGGACAAGGG - Intergenic
1009784220 6:68311286-68311308 ATTTATGAACAAATGGTTAAAGG + Intergenic
1009797397 6:68488758-68488780 ATAAATGAATAAATGGATATTGG + Intergenic
1009885993 6:69624810-69624832 AACAATGGATAAATGGATAAAGG + Intergenic
1011114161 6:83872175-83872197 CTGAATGTGCAAAAAGATAATGG - Intronic
1011227937 6:85128229-85128251 ATGTATGTACATATGTATGAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011877546 6:91979669-91979691 AAGAATGTGAGAATGGATAATGG + Intergenic
1012339838 6:98106387-98106409 ATGATTGTACAAGTAGAAAATGG + Intergenic
1012402312 6:98851925-98851947 ATCAATGGATCAATGGATAAAGG + Intergenic
1012442684 6:99276257-99276279 ATGAATGAATAAATGAATACAGG + Exonic
1012568796 6:100696282-100696304 AAGACAGTACAAATGTATAATGG + Intronic
1012973028 6:105751950-105751972 ATCAACAGACAAATGGATAAAGG - Intergenic
1013054307 6:106568424-106568446 ATGAATGTACCCATGGTGAAGGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013934557 6:115578305-115578327 ATGTATGTAAAAATTTATAAAGG + Intergenic
1013986845 6:116204315-116204337 TTGAATGTAGAAATGTAAAAGGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015038023 6:128681111-128681133 ATCAATCAACAAGTGGATAAGGG - Intergenic
1015651877 6:135471598-135471620 ATGAATGAACAAATGTATTTGGG - Intronic
1015856200 6:137627046-137627068 ATGAATGGATACATGGATAGAGG - Intergenic
1016157679 6:140832891-140832913 ATCAAAGTACAAATGTTTAAAGG - Intergenic
1016195224 6:141328114-141328136 ATTAATAGATAAATGGATAAAGG + Intergenic
1016273416 6:142318686-142318708 ATGGATCTAGAAATGGAGAAGGG + Intronic
1016387526 6:143542927-143542949 ATGAATGGACGAATGGAAACTGG - Intronic
1016423625 6:143911691-143911713 ATGAAAGAAAAAATGGTTAAGGG - Intronic
1016529790 6:145044758-145044780 CTGAATGTACGAATGGGTAATGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016620373 6:146102474-146102496 TGGAATGAGCAAATGGATAAAGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017233479 6:152096566-152096588 ATGGATGAACAAATGGCTCATGG + Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1017747919 6:157463452-157463474 ATGGATATACAAATGTATAGGGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018158461 6:161013105-161013127 AAGATTGTACAAATGTATATAGG + Intronic
1018548463 6:164964099-164964121 ATTAATGTAGAAAAGGAAAATGG - Intergenic
1019169540 6:170124756-170124778 ATGAATATCCTATTGGATAAGGG + Intergenic
1020341180 7:7112940-7112962 ATGACAGTACAACTGGATGAAGG + Intergenic
1020410871 7:7890137-7890159 AAGAATGGACAAATGGACAGGGG + Intronic
1020670433 7:11100752-11100774 AAGATTGTACAACTGGAAAATGG + Intronic
1021406834 7:20277512-20277534 ATGAATGCATGAATGAATAACGG - Intergenic
1022052643 7:26692950-26692972 ATAAATTAAAAAATGGATAAAGG + Intronic
1022376071 7:29812515-29812537 AGGAAGGTGCAAATAGATAAAGG + Intronic
1023308386 7:38855622-38855644 TTGAATGTACAAGGAGATAAGGG + Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024189550 7:46992228-46992250 ATACATGTACAAATGGATAATGG + Intergenic
1024360920 7:48467254-48467276 ATGCATGTACGAAGGGAGAAAGG - Intronic
1024479436 7:49848608-49848630 ATGATTTTACAAGTGGAGAAAGG - Intronic
1024646640 7:51376472-51376494 ATGAATGTGCAAATGGAAACTGG + Intergenic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1024820228 7:53320087-53320109 ATAAATGTATAAATGAATGATGG + Intergenic
1024930500 7:54663358-54663380 ATGAATTTACATAAGGTTAAGGG - Intergenic
1025587832 7:62815034-62815056 ATGAATGTACACATCAAAAATGG + Intergenic
1025806700 7:64839584-64839606 AGGAATGGACAAAAGGAAAAAGG + Intergenic
1026810200 7:73457476-73457498 ATGAATGTACAAATGAGTCCCGG - Intronic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027215631 7:76181720-76181742 ATGAATCAACAAATAGAAAAAGG + Intergenic
1027477280 7:78648990-78649012 AAGAATGTTGAAATGGCTAAGGG - Intronic
1027703413 7:81497956-81497978 ATGAAAGTAAAAATGTATTAAGG - Intergenic
1027760649 7:82274872-82274894 ATGAATGAATGAATGAATAATGG + Intronic
1027971110 7:85083358-85083380 ATGCATGGACCAATGGACAATGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028894472 7:96025699-96025721 ATGAATGAACAAATAGGTATTGG + Intronic
1028925855 7:96356267-96356289 AAGAATGTACAAATGCCTGAAGG + Intergenic
1029599822 7:101557213-101557235 ATGAATGAATGAATGCATAAGGG + Intronic
1030350236 7:108476742-108476764 ATGGATGAATGAATGGATAAAGG + Intronic
1030844834 7:114396377-114396399 ATCAATGGATGAATGGATAAAGG - Intronic
1031090015 7:117343095-117343117 ATCAATCAACAAATGGATAAAGG - Intergenic
1031139849 7:117930455-117930477 ATGATTTTTAAAATGGATAATGG - Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031165223 7:118219820-118219842 ATGAAAGAATTAATGGATAAAGG + Intronic
1031835350 7:126674893-126674915 ATAAATGTAGGAATGGATATGGG + Intronic
1032769227 7:135032207-135032229 ATGACTGTAAAACTGGCTAAAGG - Intronic
1033031851 7:137834454-137834476 ATGAATTCACAAATGGTGAATGG - Intronic
1033423226 7:141220819-141220841 ACAAATGAACAAATGGATGAAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035014362 7:155751954-155751976 ATAAATGAACAAATAGATGAAGG - Intronic
1035063202 7:156084633-156084655 ATCAATGGATGAATGGATAAAGG - Intergenic
1035288554 7:157822215-157822237 ATGAGTGTATAGATGGATAATGG - Intronic
1035288631 7:157822747-157822769 ATGCATGTACGCATGGATGATGG - Intronic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036076665 8:5509698-5509720 ATCAAGGTAGAGATGGATAATGG + Intergenic
1037060259 8:14499750-14499772 ATCTATATACAAATTGATAAGGG - Intronic
1037512588 8:19598861-19598883 ATGAATGGAAAAGTGAATAAAGG - Intronic
1037747597 8:21659317-21659339 ATGAATGAATAAATAGATAAAGG - Intergenic
1037943713 8:22973655-22973677 ATGAATGGAGAAATGGGTGATGG + Intronic
1038317063 8:26494576-26494598 ATGAATCTCCAAATTAATAAAGG + Intronic
1038694642 8:29795519-29795541 ATAAATGAACAAAGGGATAAAGG + Intergenic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039209205 8:35192824-35192846 CTGATTGAAAAAATGGATAAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040700906 8:50064429-50064451 ATGAATGTACAAATCTATGTAGG - Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041046335 8:53890409-53890431 ATGAATAAAAAAATGGATACAGG - Intronic
1041413749 8:57584678-57584700 ATGAATGAATGAATGGAGAACGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041638252 8:60168004-60168026 ATCAATCAACAAGTGGATAAAGG + Intergenic
1042740034 8:72032898-72032920 ATGCGTGCATAAATGGATAAAGG + Intronic
1042755703 8:72208245-72208267 ATGTGTGCATAAATGGATAAAGG + Intergenic
1043277985 8:78424827-78424849 ATGGATCTAGAAATTGATAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044124122 8:88437038-88437060 ATGAAAGAAAAAATGGGTAAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045692326 8:104772851-104772873 ATGAATGAATAAAGGAATAAAGG + Intronic
1046041974 8:108916658-108916680 GTGAATTAACAAATGGATGAAGG - Intergenic
1046124462 8:109886811-109886833 ATGAATATACAAAGACATAAAGG + Intergenic
1046461578 8:114544043-114544065 ATGAATGTACAAACAAATATGGG - Intergenic
1046772039 8:118126023-118126045 GTGAATGAACAAATGAATCAAGG + Intergenic
1046844346 8:118899353-118899375 ATGACTGAATAAATGAATAAAGG - Intergenic
1047351654 8:124080110-124080132 ATGAATGACCAAATGAACAATGG + Intronic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048169808 8:132095384-132095406 ATGAATGAGCACATGGTTAAGGG + Intronic
1048196961 8:132339299-132339321 ATGAATGAATAAATGAGTAACGG - Intronic
1049320653 8:141994541-141994563 ATGAATGGATGCATGGATAATGG - Intergenic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1050411117 9:5366226-5366248 ATGAATGTACACATAGTTAAAGG - Intronic
1050842045 9:10162303-10162325 GTCAATGTATGAATGGATAAAGG + Intronic
1050960714 9:11726783-11726805 ATGAAAATATCAATGGATAACGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051121511 9:13757090-13757112 ATGAACGAACAAATGGATGATGG - Intergenic
1051832072 9:21290707-21290729 ACTAATGTAAAAATAGATAAAGG + Intergenic
1051992497 9:23169307-23169329 ATGAATGTATAAACAAATAAAGG + Intergenic
1052162359 9:25280498-25280520 GTGAATGTACAAATAAATCATGG + Intergenic
1052333046 9:27290541-27290563 ATGGATGTACACATGTATAAAGG - Intronic
1052764325 9:32625378-32625400 AGGAATGTACAATCAGATAAGGG - Intergenic
1053205387 9:36182023-36182045 ATCAACTGACAAATGGATAAAGG + Intergenic
1053896867 9:42751081-42751103 ATCAATGAATGAATGGATAAAGG + Intergenic
1054918877 9:70522019-70522041 ATGAATGAACAAATGAATAATGG - Intergenic
1054987063 9:71274096-71274118 ATGGATGAACTAATGGATAAGGG - Intronic
1055581950 9:77715240-77715262 ATGATGGTACAAATAGATCATGG + Intergenic
1055706335 9:79008896-79008918 ATAAATGTACAAAAGAAGAAAGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055858585 9:80722252-80722274 ATGAATGAACAAAAGAACAAAGG - Intergenic
1055960842 9:81818779-81818801 AGGAATCTAAAAATGGAGAAGGG - Intergenic
1056922166 9:90801092-90801114 AGGAATGTCCAAAAGGAAAAGGG + Intergenic
1057020189 9:91691350-91691372 ATAAATATACAAATGGATTATGG - Intronic
1057278321 9:93688997-93689019 AGCAATGAACAAATGGAAAATGG + Intergenic
1058643920 9:107112817-107112839 ATGAATGTACGTATGAAAAAGGG + Intergenic
1058756509 9:108087747-108087769 ATGAATGAACAAATTAATTAAGG + Intergenic
1058909965 9:109511971-109511993 ATAAATGAACAAATGGATCTTGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059758261 9:117313904-117313926 GTCAAAGTACAAAGGGATAAAGG - Intronic
1059934885 9:119299780-119299802 ATCAGTGGACATATGGATAAAGG - Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060399070 9:123337120-123337142 ATGAATGAACAAATGAATGAAGG - Intergenic
1061244647 9:129395186-129395208 ATGAATGAAAAAATGGATGGAGG + Intergenic
1061417477 9:130454914-130454936 ATGAATGGATGGATGGATAATGG - Intronic
1061417514 9:130455113-130455135 ATGGATGAATAAATGGATGATGG - Intronic
1062172270 9:135141566-135141588 ATGAGTGGACAGATGGATGATGG + Intergenic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1185503921 X:618696-618718 ATGAATGGATGAATGGATGAAGG + Intergenic
1185632753 X:1527364-1527386 ATGAATGGGCAAATGAATAGTGG - Intronic
1185744350 X:2560044-2560066 ATGGATGTATATATGGATGATGG + Intergenic
1185832952 X:3318792-3318814 ATCAATGAATGAATGGATAAAGG + Intronic
1185840705 X:3388111-3388133 ATGAATGGATAAATAGATGATGG - Intergenic
1185883520 X:3761207-3761229 ATGAATGTATGGATGGATGAGGG + Intergenic
1187048523 X:15674126-15674148 ATGAATGAATGAATGGCTAATGG + Intergenic
1187436278 X:19272982-19273004 GTGAATGGACAAAGGGATAGGGG + Intergenic
1187761215 X:22587887-22587909 ATGAATGTGCAAATGTATAAGGG - Intergenic
1187777429 X:22777848-22777870 ATAAATGTACAAATAAAAAATGG - Intergenic
1188029951 X:25253202-25253224 ATGAATGAACAAATGAATGAGGG + Intergenic
1188256759 X:27971190-27971212 ATGAATATAGATATAGATAACGG - Intergenic
1188305414 X:28555944-28555966 TTGAATGTTGAAATGGTTAAAGG - Intergenic
1188617540 X:32176905-32176927 ATGAATGGTTAAATGCATAAGGG - Intronic
1188761500 X:34037105-34037127 ATCAATGGATAAATGGATAAAGG + Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190475295 X:50821272-50821294 ATCAATGCATGAATGGATAAAGG + Intergenic
1190708097 X:53047663-53047685 ATGAAGGAACCAATGGATGAAGG + Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1192303962 X:69938272-69938294 ATAAAAGTTAAAATGGATAAAGG + Intronic
1192654633 X:72980345-72980367 ATGAATGGACAAATGAAATATGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194341418 X:92711033-92711055 ATCACTGAACAAATGTATAATGG + Intergenic
1194376972 X:93148693-93148715 ATTAATATGCAAATAGATAAAGG + Intergenic
1194725887 X:97396668-97396690 CTGAATGTGCAAAAGGATTATGG + Intronic
1195001580 X:100647987-100648009 ATGAATGAACAAAGGCATGAAGG - Intronic
1195422906 X:104695477-104695499 ATGAATGTGCATATGACTAAGGG + Intronic
1195858200 X:109353192-109353214 ATGAATGAGAAAATGGATAGAGG - Intergenic
1195885328 X:109631314-109631336 ATGAATAGACAAATAGATAGAGG - Intronic
1195916124 X:109937422-109937444 ATGTATGTACAAAGGGTTATGGG - Intergenic
1196798793 X:119523871-119523893 ATGAATGAACAAGTGGAGACTGG + Intergenic
1197164753 X:123364721-123364743 GTCCATGAACAAATGGATAAAGG + Intronic
1197292473 X:124675810-124675832 ATGAAGGTAAAAATAGGTAAGGG + Intronic
1197882207 X:131178561-131178583 ATGAATGTATGAATGGAGCAGGG + Intergenic
1197971147 X:132116412-132116434 TTTCATGTACAAATGGAAAATGG - Intronic
1198164004 X:134035537-134035559 ATGAGCATATAAATGGATAAAGG + Intergenic
1198522977 X:137471516-137471538 ATGAATGGACGAATGAATATAGG - Intergenic
1198558033 X:137816880-137816902 ATCAATGGATAAATGGATAATGG - Intergenic
1199784630 X:151093471-151093493 ATGGATGGATGAATGGATAAAGG - Intergenic
1199921539 X:152409968-152409990 ATCAATGAATAAATGGGTAAAGG + Intronic
1200362020 X:155617056-155617078 AAGAATGTATAAATGCACAAGGG - Intronic
1200649769 Y:5827736-5827758 ATCACTGAACAAATGTATAATGG + Intergenic
1200781572 Y:7221058-7221080 ATGAATTGATAAATGTATAATGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201538538 Y:15080207-15080229 ATGTAGTTAAAAATGGATAACGG + Intergenic