ID: 957133398

View in Genome Browser
Species Human (GRCh38)
Location 3:76252064-76252086
Sequence TCTGCTCAAATGTCTACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957133398_957133400 10 Left 957133398 3:76252064-76252086 CCACAGGTAGACATTTGAGCAGA 0: 1
1: 0
2: 2
3: 20
4: 163
Right 957133400 3:76252097-76252119 AACTTAATAAGCAATTCATGAGG 0: 1
1: 0
2: 0
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957133398 Original CRISPR TCTGCTCAAATGTCTACCTG TGG (reversed) Intronic
900778642 1:4602678-4602700 TCTACTCAGATGTCCACCTAAGG - Intergenic
902107081 1:14046865-14046887 TCTGCCAAAATGTCTTCCTTGGG - Intergenic
906846669 1:49200133-49200155 TCTGCTCAGATTTCTGCCTAGGG + Intronic
908111666 1:60904284-60904306 ATTCCTCAAATGTCTCCCTGGGG + Intronic
908455721 1:64303011-64303033 TCAGCTGAAGTGTCTACATGTGG + Intergenic
908631322 1:66111667-66111689 TCTTCTCAAATGTTTACCAACGG - Intronic
908905245 1:69001022-69001044 ACTGCTCAAAAGTCATCCTGGGG + Intergenic
910373400 1:86542882-86542904 TCTGCTGGAATGTCTACCTGAGG + Intergenic
916628179 1:166582360-166582382 TTTGCTCAAATGTCATCTTGGGG + Intergenic
916649041 1:166817692-166817714 TCTGCTCCATTTTCTCCCTGAGG + Intergenic
916815373 1:168346636-168346658 ACTGCTTAAATGTCCACCAGTGG + Intergenic
918765592 1:188479051-188479073 TCTGCTGAAAGGTCTGCTTGTGG + Intergenic
919975333 1:202607011-202607033 ACTGCCTAAATGTCTACCAGTGG - Intronic
920126267 1:203695869-203695891 TCTGTTCAGATGTCTTCCTCAGG + Intronic
921305146 1:213788788-213788810 TCTCCTCAACTGTCCAGCTGAGG - Intergenic
922047738 1:221963161-221963183 TCTGATAAAATGTGTACCTATGG + Intergenic
1062903143 10:1160810-1160832 TCAGCTAACATGGCTACCTGTGG - Intergenic
1064249411 10:13695464-13695486 TCTGCTCCAGTTTCTACCTTCGG + Intronic
1072182901 10:93005681-93005703 TCTGCCCAAATGTCTAAGTTAGG + Intronic
1074254862 10:111791816-111791838 TCTGCTCAATGGTATACATGTGG - Intergenic
1074339093 10:112608517-112608539 TTTGCCCACATGTCTACATGTGG - Intronic
1075010578 10:118866265-118866287 TCTGCACAAAGGCCTCCCTGGGG - Intergenic
1076428328 10:130383173-130383195 AGTGCTCAAATGTCTCCTTGGGG + Intergenic
1076731561 10:132441502-132441524 TCTGCTCCAACGTTTGCCTGGGG - Intergenic
1084663946 11:70565798-70565820 TCTGCTCCAACTTCTACTTGTGG - Intronic
1084839625 11:71834652-71834674 TCTGCTTCAATGTCTACCTAAGG - Intronic
1085940044 11:81197790-81197812 TCTCCCCAAAGGACTACCTGGGG - Intergenic
1087572078 11:99941668-99941690 TCTGCTCAAATGACTCCCTGTGG - Intronic
1090912465 11:131133492-131133514 TCTGCTCACAAGTCTCCCAGTGG + Intergenic
1092281778 12:7102827-7102849 TCTGCTCAAATACCTTCCTGTGG + Intronic
1092404367 12:8207981-8208003 TCTGCTGCAATGTCTACCTAAGG + Intergenic
1093756487 12:22858878-22858900 TCTGCTCAGATGCCTACCAAAGG - Intergenic
1097390181 12:59002033-59002055 TGTGTCCAAATGTCTACATGAGG + Intergenic
1097969947 12:65622941-65622963 TCTGCTCAAATGTCAACTTTTGG - Intergenic
1100856675 12:98763406-98763428 TCTGCTAAGATGTCTATCTGGGG + Intronic
1101439141 12:104690113-104690135 TCTGCTCAATTGATTTCCTGTGG - Intronic
1102818586 12:115888611-115888633 TCTCCTCAGCTGTCTACCTGAGG + Intergenic
1107452009 13:40518335-40518357 TCTGCTAAAATGTCTGCCTTCGG + Intergenic
1108060640 13:46529578-46529600 TCTGCTCAATTGCCTATGTGAGG + Intergenic
1108808735 13:54193195-54193217 TCTGGTAAAAAGACTACCTGAGG - Intergenic
1108935854 13:55879129-55879151 TCTCCCCAAATGACTACCTGGGG + Intergenic
1112248454 13:97755946-97755968 TCTTTTGAAATGTCTACCAGAGG + Intergenic
1114031878 14:18585811-18585833 TCGTGTCTAATGTCTACCTGGGG + Intergenic
1114076649 14:19164840-19164862 TCGTGTCTAATGTCTACCTGGGG + Intergenic
1115262564 14:31469050-31469072 TCTACGCAAATCTCTACCTCTGG - Intergenic
1116121194 14:40723700-40723722 TCTTCTCAGATGTTTACCTAAGG + Intergenic
1119227354 14:72954521-72954543 TCTGGCCAAATTTCTACATGGGG - Intronic
1120449119 14:84643373-84643395 TCTGCTTAAATGTCTAAGTCTGG - Intergenic
1120603151 14:86537665-86537687 TCTGCAGAAATGACTAGCTGAGG + Intergenic
1126124656 15:45284437-45284459 TCTGCCCAAATTCCTACCTAAGG + Intergenic
1130896020 15:88171082-88171104 TCTGGTCAACTGTCCACCTCAGG - Intronic
1132053391 15:98630351-98630373 TCTACTAAAATGTCTTCCTTCGG - Intergenic
1133187121 16:4107946-4107968 TCTGCCCAAATGCATACCAGCGG + Intronic
1135420254 16:22301097-22301119 TTTGCTCAAATGTCACCTTGTGG - Intronic
1137691577 16:50431708-50431730 TTTGCTCAAATGTTCACCAGGGG - Intergenic
1138842032 16:60521782-60521804 TCAACACAAATGTCCACCTGTGG + Intergenic
1139116038 16:63954224-63954246 TCTGTTCAAAAGTGTATCTGTGG + Intergenic
1140768151 16:78178953-78178975 GCTGGTCAAATGTTTACATGGGG + Intronic
1145259792 17:21347823-21347845 TCTGCTCAAATGTCTCCTCCAGG - Intergenic
1145316823 17:21740115-21740137 TCTGCTCAAATGTCTCCTCCAGG + Intergenic
1148660509 17:49327546-49327568 GGTGCTCAAAGATCTACCTGGGG + Intronic
1155146262 18:23086221-23086243 TCTTCCCAAATGCCTACCTAAGG - Intergenic
1162685113 19:12376462-12376484 TCTTCTCAACTGTCTCACTGTGG - Intergenic
1163467392 19:17476207-17476229 TCTGCTCTAAGGGCTTCCTGTGG - Intronic
1163544747 19:17934413-17934435 ACAGCCCAAATGTCTAGCTGTGG + Intronic
1167531587 19:50021033-50021055 TCTGCTCAGATGCCTCCCTCTGG - Intronic
926433047 2:12809496-12809518 TCAGCTGAAATGCCTACCTCTGG + Intergenic
926449257 2:12982490-12982512 TGTGATCAAATGTTTACCTATGG + Intergenic
931859252 2:66336566-66336588 TCTGCTCAAAGGTGACCCTGAGG + Intergenic
935103422 2:100017854-100017876 TCTGCTCCACTGCCTCCCTGGGG + Intronic
938491251 2:131762356-131762378 TCGTGTCTAATGTCTACCTGGGG + Intronic
938496312 2:131799981-131800003 TCGTGTCTAATGTCTACCTGGGG - Intronic
938986418 2:136580780-136580802 GGTGGTCAAATGTCTCCCTGTGG + Intergenic
942452503 2:176117059-176117081 TCTGTCCAACTGTCTACTTGAGG - Exonic
943890535 2:193280916-193280938 TGTGTTGAAATGTCTAGCTGTGG - Intergenic
944720553 2:202419084-202419106 TCTCCTCAAATTTCTATCTGAGG - Intronic
946110208 2:217408365-217408387 TCAGCTCAGATGTCTACCCCTGG + Intronic
946647627 2:221855233-221855255 TGTGCTCATAGGTCTATCTGTGG + Intergenic
948080419 2:235200902-235200924 TTTGCTCAGAAGTCTTCCTGAGG - Intergenic
1168949077 20:1784235-1784257 TCTACCCTAATGTCTCCCTGTGG + Intergenic
1169746982 20:8952567-8952589 GCTGCTGAAATGTCAACCAGTGG - Intronic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170314219 20:15025812-15025834 TCTTGTCAAATGTCCTCCTGGGG + Intronic
1170676871 20:18490366-18490388 TTTGCTCAGATTTCTACCTTTGG + Intronic
1170677202 20:18493511-18493533 TCTGCTCAAATGTCCCCTTTTGG - Intronic
1173916665 20:46713164-46713186 TCTTCTCAGCTGTCTCCCTGAGG - Intronic
1175502391 20:59459842-59459864 TTTACTCTAATGTCTGCCTGAGG + Intergenic
1176708382 21:10131215-10131237 TCGTGTCTAATGTCTACCTGGGG + Intergenic
1178745685 21:35248160-35248182 TAGGCTCAATTGTGTACCTGTGG + Intronic
1178893023 21:36535873-36535895 TTTGCTCTAAGGTGTACCTGTGG - Intronic
1180292458 22:10858465-10858487 TCGTGTCTAATGTCTACCTGGGG + Intergenic
1180455992 22:15512868-15512890 TCGTATCTAATGTCTACCTGGGG + Intergenic
1180495264 22:15887887-15887909 TCGTGTCTAATGTCTACCTGGGG + Intergenic
1181323461 22:22026113-22026135 TCTGCTCAGGTGACTGCCTGTGG + Intergenic
1184041897 22:41949327-41949349 TCTGCTCAAATGTCACCTTAGGG - Intergenic
949110104 3:249902-249924 TCTTCTAAAATCTGTACCTGGGG + Intronic
949388239 3:3529734-3529756 ACTACTCAAATGTCAATCTGTGG - Intergenic
949539633 3:5021939-5021961 TCTGTGCAAATGTATGCCTGTGG - Intergenic
949835936 3:8270042-8270064 ACAGCTCAAATGTCTATCAGTGG + Intergenic
953069705 3:39506818-39506840 TTTGCTCTAATGGTTACCTGTGG + Intronic
955727281 3:61946963-61946985 TCTGCTAAAATCTCTTCTTGGGG + Intronic
955922266 3:63969879-63969901 TCTTCTCACCTGTATACCTGAGG + Intronic
957133398 3:76252064-76252086 TCTGCTCAAATGTCTACCTGTGG - Intronic
959432774 3:106275386-106275408 ACTGCACAAATGTCTAACTATGG - Intergenic
960296940 3:115955866-115955888 TCTGCCCAAATGTTTAAATGAGG - Intronic
962448557 3:135492026-135492048 TCTGTTCAAATATCAACATGTGG - Intergenic
963443300 3:145368669-145368691 TCTGCTCTAATATCTACTTTTGG + Intergenic
965365583 3:167795317-167795339 TCTGCTCAAAATTCTCCCTGTGG + Intronic
965803301 3:172516280-172516302 TCTGCTGAATTGACTACCTAGGG + Intronic
969171751 4:5369522-5369544 GCAGCTCTGATGTCTACCTGTGG + Intronic
969761690 4:9189718-9189740 TCTGCTGCAATGTCTACCTAAGG - Intergenic
969780706 4:9400664-9400686 TCTTCTTCAATGTCTACCTAAGG - Intergenic
975208019 4:71666502-71666524 TCTGCTCAAATTTGTTCCTCAGG + Intergenic
975985835 4:80201284-80201306 GCTGCTGAGGTGTCTACCTGCGG - Exonic
979931992 4:126642515-126642537 TCTGCTCAAATTCTAACCTGGGG - Intergenic
987653813 5:20779474-20779496 GTTGCTCAAATTTCTACTTGGGG + Intergenic
988741763 5:34082019-34082041 GTTGCTCAAATTTCTACTTGGGG - Intronic
989304007 5:39930319-39930341 TCTAGTCAAATGTCTAGATGGGG + Intergenic
990536614 5:56729759-56729781 TCTGCTCAAATGTAACCATGGGG - Intergenic
994192462 5:96883375-96883397 ATTACTCAAATGTCTATCTGAGG + Intronic
996028753 5:118681842-118681864 TATGGTCAAATGTCCATCTGCGG - Intergenic
996849119 5:127933006-127933028 CCTGCACAATTGTATACCTGAGG - Intergenic
999586325 5:153093446-153093468 TCTCCTAAAATGTCTTCCTCAGG - Intergenic
1006781875 6:36637561-36637583 TCTGCTGAAAGGCCTACCTCAGG - Intergenic
1007078365 6:39082162-39082184 TCTGCTGAACTGGCTACCTGTGG + Intronic
1008563160 6:52741651-52741673 TCTGCCCATATGTCAACCTGAGG - Intergenic
1008568713 6:52794193-52794215 TCTGCCCGTATGTCCACCTGAGG - Exonic
1008573169 6:52834209-52834231 TCTGCTCATATGTCAACCAGAGG - Exonic
1008574854 6:52850297-52850319 TCTGCCCATATGACAACCTGAGG - Intronic
1008580213 6:52900002-52900024 TCTGCCCTTATGTCGACCTGAGG - Exonic
1008644546 6:53500626-53500648 TCTGCTCAAATGCTTCCCAGTGG + Intronic
1009715326 6:67385449-67385471 TCTGAACATATATCTACCTGGGG - Intergenic
1011384309 6:86778355-86778377 TCTGTCCAAATTTCTACCTCAGG - Intergenic
1012541973 6:100371872-100371894 TCTTCTCAGATCTTTACCTGTGG - Intergenic
1017239762 6:152154769-152154791 TCTGCTCAAATTGCTGCGTGAGG - Intronic
1017522069 6:155211277-155211299 TCTGCTCCATTTTCTCCCTGTGG - Exonic
1018105961 6:160486643-160486665 TCTGATGAAATTTGTACCTGTGG - Intergenic
1018957896 6:168423499-168423521 TCTGCTCAAATGTTTCATTGTGG - Intergenic
1019849992 7:3545239-3545261 TCTTCTCTACTTTCTACCTGAGG - Intronic
1021808280 7:24378185-24378207 TTTGCTCCAAAGTCTACTTGTGG + Intergenic
1022215662 7:28258387-28258409 TCTGTTGAAATGTTTACTTGTGG - Intergenic
1023428205 7:40061981-40062003 TCTACTCAAGTATCTACTTGAGG - Intronic
1023658997 7:42454361-42454383 TCTGATGAGAAGTCTACCTGCGG + Intergenic
1029156706 7:98522380-98522402 TCTGCCCAAATGTATACCCTGGG - Intergenic
1029712817 7:102308809-102308831 TCGGCTCCATTCTCTACCTGGGG - Exonic
1030564308 7:111133719-111133741 TCTTCTCATATTTCTACCTCTGG - Intronic
1036271780 8:7311543-7311565 TCTGCTGCAGTGTCTACCTAAGG - Intergenic
1036278142 8:7374597-7374619 TCTGCTTCAATGTCTACCTAAGG - Intronic
1036343380 8:7937294-7937316 TCTGCTTCAATGTCTACCTAAGG + Intronic
1036349568 8:7998803-7998825 TCTGCTGCAGTGTCTACCTAAGG + Intergenic
1036641596 8:10587767-10587789 TCTGCTGCAATGTGAACCTGAGG - Intergenic
1036646639 8:10615020-10615042 TCTGCCCAGATGTGCACCTGGGG - Intronic
1036838720 8:12098056-12098078 TCTGCTTCAATGTCTACCTAAGG + Intergenic
1036844842 8:12159306-12159328 TCTGCTGCAATGTCTACCTAAGG + Intergenic
1036860508 8:12344300-12344322 TCTGCTTCAATGTCTACCTAAGG + Intergenic
1036866213 8:12401638-12401660 TCTGCTGCAATGTCTACCTAAGG + Intergenic
1037630464 8:20651095-20651117 TTTGTTCAAATGTCTCCTTGAGG - Intergenic
1038522290 8:28243810-28243832 TTTGCTCTAATTTCTTCCTGAGG + Intergenic
1038534096 8:28341701-28341723 TCTGCTCAAATGTCAAGTTCTGG + Intronic
1039914150 8:41847280-41847302 TCAGCTCTAAGGTTTACCTGGGG + Intronic
1040807095 8:51406851-51406873 TCTGCTCAGATGTAGCCCTGTGG - Intronic
1044489336 8:92793560-92793582 TCTAATACAATGTCTACCTGGGG + Intergenic
1045322987 8:101095853-101095875 TCTGCTCAAATGCCACCATGTGG + Intergenic
1047826009 8:128576224-128576246 GCTGTTCAAATGTTTTCCTGGGG + Intergenic
1048470592 8:134700734-134700756 TCTGCTCAAACATCATCCTGTGG + Intronic
1052838080 9:33266004-33266026 TCTGCTCTACTGTCCACCTTAGG - Exonic
1053645342 9:40116728-40116750 TCGTGTCTAATGTCTACCTGGGG + Intergenic
1053760372 9:41346799-41346821 TCGTGTCTAATGTCTACCTGGGG - Intergenic
1054326364 9:63714629-63714651 TCGTGTCTAATGTCTACCTGGGG + Intergenic
1054539230 9:66259243-66259265 TCGTGTCTAATGTCTACCTGGGG - Intergenic
1056045772 9:82714036-82714058 TCTGCCCAATTGTGTGCCTGAGG - Intergenic
1058525566 9:105854610-105854632 TTTGGTCAAATTTCTCCCTGGGG + Intergenic
1060463355 9:123879671-123879693 TTTCCTCAAATTTCTACCTCTGG - Intronic
1061298959 9:129693834-129693856 TCTCTTCAAATGTCTTTCTGTGG + Intronic
1061653639 9:132070678-132070700 TGTGCACAAATATCTGCCTGGGG + Intronic
1202793143 9_KI270719v1_random:100184-100206 TCGTGTCTAATGTCTACCTGGGG + Intergenic
1185694467 X:2184911-2184933 TCTGCTCATCTATCTATCTGTGG + Intergenic
1186405843 X:9301589-9301611 TCTCCTCGAACGTCTTCCTGAGG - Intergenic
1188592584 X:31856324-31856346 TGTTCTCATATGTCTATCTGAGG + Intronic
1190888588 X:54550536-54550558 TCTGTGCAGCTGTCTACCTGAGG - Intronic
1191660267 X:63642270-63642292 TCTGCTCACATTTCTGTCTGAGG + Intronic
1192279605 X:69671099-69671121 TCTGCTCAATTGTCACCCTCAGG - Intronic
1193964840 X:87972772-87972794 TTTGCTCACATGTTTTCCTGCGG + Intergenic
1195093986 X:101488794-101488816 TCTGCTCCAATCTCGACTTGGGG - Exonic
1198910094 X:141603846-141603868 TCATTTCAAATGTCTACCTATGG - Intronic
1201937064 Y:19420674-19420696 ACTGCTCTAATGCCTTCCTGGGG - Intergenic