ID: 957136899

View in Genome Browser
Species Human (GRCh38)
Location 3:76299784-76299806
Sequence GAGTCCATAGGATTTTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957136899 Original CRISPR GAGTCCATAGGATTTTGAGG TGG Intronic
901723068 1:11215992-11216014 AAGCCCACTGGATTTTGAGGGGG - Intronic
904281108 1:29418826-29418848 GAATCCATTGGATTTTGAGAAGG - Intergenic
904357613 1:29951012-29951034 GAGCCCAGAGGGTTTTGAGGAGG - Intergenic
906813260 1:48850859-48850881 AAGTTCATTGGATTTTGAGTCGG + Intronic
907071418 1:51538965-51538987 GAGTCCAGAGGATTTTAGGGTGG - Intergenic
912228141 1:107759531-107759553 TACTCCATAGAATTTTGAGAGGG + Intronic
914854504 1:151341437-151341459 GAATCCATGTGATTTTGGGGAGG + Exonic
915856099 1:159387759-159387781 GAGGACATAGGATTTTGGAGGGG + Intergenic
916484568 1:165247339-165247361 AATTCTACAGGATTTTGAGGAGG + Intronic
917941451 1:179926623-179926645 GAGTCTAGAGAATTTTGAGTAGG + Intergenic
918741385 1:188135295-188135317 AAGTCCATATGATTTTGGAGGGG + Intergenic
918971216 1:191421718-191421740 GTTTCCATAGGATTTTGATCTGG - Intergenic
920572556 1:207028715-207028737 AAGTCCCAAGGATTTTGATGTGG + Intronic
920894325 1:210029741-210029763 GATTCCATATGAATTTTAGGAGG + Intronic
1063099516 10:2937105-2937127 TAGTCCAAAGGATTTTGAGAGGG + Intergenic
1065841481 10:29704850-29704872 GAGTCCTGGGGATTTTCAGGGGG + Intronic
1065945125 10:30599258-30599280 AAGTCCATTGGATTTGGAGCAGG - Intergenic
1068718314 10:60213021-60213043 GAGTTCATAGACTTTTAAGGAGG - Intronic
1068961896 10:62875175-62875197 GATTCCATATGAATTTAAGGAGG + Intronic
1071257326 10:83882733-83882755 GAGTTCAGAGGATTTTGAGTAGG - Intergenic
1074177639 10:111026033-111026055 GAGCACAGAGGATTTTTAGGTGG + Intergenic
1075906175 10:126083730-126083752 GAGTCACGAGGCTTTTGAGGCGG - Intronic
1078903470 11:15662961-15662983 GAATGGATAGGATTTTGATGGGG - Intergenic
1081192504 11:40120662-40120684 GAGACCCTAGGATTCTGAGAAGG - Intronic
1082811409 11:57481342-57481364 AAGGCCAAAGGATCTTGAGGTGG - Intergenic
1083257022 11:61502889-61502911 GAGGCCACAGGAGTGTGAGGAGG - Intergenic
1083314734 11:61807461-61807483 GAGACCAAAAGATTTTGATGGGG - Intronic
1084764428 11:71298940-71298962 GAGTCCTTAGGATAGGGAGGCGG + Intergenic
1085659038 11:78345698-78345720 GAGTCCACAGAATTTTTAGTAGG + Intronic
1086696630 11:89854763-89854785 GAGTCCTTAGGCTTTTTAGCAGG - Intergenic
1086709528 11:89989727-89989749 GAGTCCTTAGGCTTTTTAGCAGG + Intergenic
1087889721 11:103523428-103523450 GAATGCATAAGATGTTGAGGTGG + Intergenic
1089139502 11:116274582-116274604 GAGTCTATGTGGTTTTGAGGGGG + Intergenic
1090624235 11:128592004-128592026 GAGTCCACAGGATGTTTAGCAGG - Intergenic
1090643733 11:128750464-128750486 GAGTCCAGTGGAGTTAGAGGAGG - Intronic
1094094848 12:26692120-26692142 GTGTCCATAGAATTTGGCGGGGG - Intronic
1095840407 12:46685692-46685714 GAGTCCATGGGACTTGGAGTTGG - Intergenic
1099673223 12:85721739-85721761 TAACCCATAGGATTTTGAGGTGG - Intergenic
1101576660 12:106003692-106003714 GAGTCAATAGGATTTCCAGATGG + Intergenic
1106372917 13:29153943-29153965 GAGTCGAAAGGGTATTGAGGTGG + Intronic
1107076914 13:36332025-36332047 GATTTCATAGGATTGTTAGGAGG - Intronic
1109152460 13:58861071-58861093 ATGTCCAGAGGATGTTGAGGGGG - Intergenic
1109158385 13:58940409-58940431 GAGTCAATAGTAATTTGTGGTGG - Intergenic
1111178793 13:84635481-84635503 GAGTCCAGAGGATTTGGTGTGGG + Intergenic
1111232994 13:85368944-85368966 GAGTCCACAGGAATTTCATGGGG - Intergenic
1113165343 13:107434445-107434467 GAGACCATACGATTTGGATGAGG + Intronic
1113770771 13:112907122-112907144 GATTACACAGGATTCTGAGGGGG + Intronic
1114176806 14:20329278-20329300 AAGCCCATATGATTTTCAGGGGG + Exonic
1115061599 14:29197959-29197981 GAGTCCATGGGTTTATAAGGTGG - Intergenic
1116737087 14:48705450-48705472 GAGCCGATAGAATTTGGAGGAGG - Intergenic
1119050344 14:71361673-71361695 GAGACCTTAGGATTTTTAAGTGG + Intronic
1119693033 14:76691746-76691768 GAGTCCATGGGATTCTGTTGAGG + Intergenic
1119771308 14:77221776-77221798 AAGTCCATTGGATTTAGCGGTGG - Intronic
1120524945 14:85567206-85567228 GTGTCCATGGGATTCTGAGGGGG - Intronic
1124993809 15:34702732-34702754 GAGTCTATAGGTTTCTGTGGTGG - Intergenic
1127004538 15:54551451-54551473 GAGTTCATAGGATTTGGATTGGG - Intronic
1131427593 15:92359600-92359622 GAGTCCAGAGGATTTGGGGGAGG + Intergenic
1133909670 16:10053570-10053592 AAGTTCATAGGAGTTTTAGGAGG + Intronic
1139435041 16:66932007-66932029 GAGTCATTTGGAGTTTGAGGGGG - Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1142490675 17:276851-276873 GAATCCACAGAATTTTGAGTGGG + Intronic
1148106736 17:45122877-45122899 GAGTCCATGGCCTTTGGAGGTGG + Intronic
1159372867 18:67551612-67551634 GAGTTCACAGAATTTTCAGGAGG + Intergenic
1159386544 18:67732839-67732861 GATTCTTTAGGATTTTTAGGGGG + Intergenic
1161603421 19:5199891-5199913 AAGTCTTTGGGATTTTGAGGGGG + Intronic
926957054 2:18312979-18313001 AAGAGCATAGGATTTTGAGGTGG + Intronic
928124408 2:28605812-28605834 GAACCAATAGGATCTTGAGGGGG + Intronic
928282146 2:29957166-29957188 GAGTGGATAGGATTTGTAGGAGG + Intergenic
934614689 2:95763871-95763893 GTGGCCATGGGAGTTTGAGGAGG + Intergenic
934734825 2:96684825-96684847 GAATGCATAGGATTTTGTTGGGG + Intergenic
936166668 2:110126578-110126600 GGGTCCTTAGGAGTTTGAAGAGG + Intronic
937358727 2:121214320-121214342 GGGTCCGTATGATTTTGAGCAGG - Intergenic
939593910 2:144101283-144101305 AGGTCCATGGGATTTAGAGGTGG - Intronic
939812233 2:146848452-146848474 GAGTTAATAGGATTTTAAGAAGG + Intergenic
942136700 2:172933294-172933316 GAGTCCATAGGATTTTCTGATGG + Intronic
945807787 2:214511342-214511364 GCTTCCATATGAATTTGAGGGGG - Intronic
947104907 2:226659360-226659382 GAGTAGATAGGATTTTCAGTGGG - Intergenic
1173258904 20:41415569-41415591 GCGTCCCTATGAGTTTGAGGTGG - Exonic
1174749209 20:53095453-53095475 GAGTCCATGTGATTCTCAGGGGG - Intronic
1177303811 21:19286516-19286538 TAGACCATAGGATTTTCATGGGG - Intergenic
1177396766 21:20546644-20546666 GATTCAATGGGATTTTTAGGTGG - Intergenic
1178634962 21:34294393-34294415 GAGTCCATAGGGTTTCTAGTAGG + Intergenic
1179534169 21:42040554-42040576 GAGTCAAAAGGAATTTGAAGAGG - Intergenic
1182038545 22:27218533-27218555 GACTCCCTGGGATCTTGAGGGGG - Intergenic
950483308 3:13258091-13258113 GAGCACAGAGGATTTTGCGGGGG + Intergenic
953850799 3:46464336-46464358 GGGTCCACAGGGTTGTGAGGAGG - Intronic
955067186 3:55543692-55543714 CAGTCCATAGGATCTGGAGGAGG + Intronic
957136899 3:76299784-76299806 GAGTCCATAGGATTTTGAGGTGG + Intronic
965405499 3:168263359-168263381 GAGACCCTAGGATTTAGATGAGG - Intergenic
968604591 4:1527564-1527586 GATTCCATATGAATTTTAGGAGG + Intergenic
970663481 4:18311699-18311721 GAGGACATAGGATTTTGGAGGGG - Intergenic
971395724 4:26225471-26225493 GAGCACAGAGGATTTTCAGGTGG + Intronic
974122257 4:57653653-57653675 GAGTTGATAGGATTTTGGTGTGG + Intergenic
975980048 4:80147106-80147128 CACTCCAGAGGATTTTGAGGAGG - Intergenic
978969944 4:114791686-114791708 GAGTCTTAAGGGTTTTGAGGAGG - Intergenic
984172170 4:176372721-176372743 TATTCCAAAAGATTTTGAGGAGG + Intergenic
985015868 4:185635389-185635411 TAGTCCAGAGGCTTTTTAGGAGG + Intronic
986534422 5:8772185-8772207 GGATCAGTAGGATTTTGAGGAGG + Intergenic
988482642 5:31642556-31642578 TAATCCACAGTATTTTGAGGAGG + Intronic
988912011 5:35852654-35852676 CAGTCCCTACGATTCTGAGGGGG - Intergenic
992573300 5:78082683-78082705 GAGTTCTTAGCATTTTAAGGTGG + Intronic
992863144 5:80932366-80932388 ATTTCCATTGGATTTTGAGGGGG + Intergenic
994767570 5:103938253-103938275 GTGCCCTTAGGATTTTGAGGTGG - Intergenic
995081848 5:108060727-108060749 GAGGCCATAGGATTGTGTGTGGG - Intronic
996255689 5:121400453-121400475 GAATAGATAGGATTCTGAGGAGG + Intergenic
998080739 5:139273359-139273381 GAGTCCATATGATTCTGCTGGGG - Intronic
998474719 5:142410822-142410844 GAGTTCATAATATTTTGAGTGGG - Intergenic
998538030 5:142952454-142952476 CGGTACATAGGATGTTGAGGGGG - Intronic
1002103090 5:176866961-176866983 GAGCCCAGAGGCTTGTGAGGAGG + Intronic
1006155445 6:32010732-32010754 GTGTCCACAGGATTCTGGGGGGG + Intergenic
1006161751 6:32043466-32043488 GTGTCCACAGGATTCTGGGGGGG + Exonic
1007879544 6:45148266-45148288 GACCTCATAGGAGTTTGAGGAGG - Intronic
1007996366 6:46312385-46312407 GAGTTTTTAGGAATTTGAGGAGG + Intronic
1008013064 6:46489748-46489770 CAGTCCATAGAATTTTGTGAGGG - Intronic
1008300018 6:49825376-49825398 TAATCCATAGGATTTTTAGAGGG + Intergenic
1010458079 6:76082204-76082226 GAGTACATAAGATTTGGGGGTGG - Intergenic
1013461139 6:110376577-110376599 GAGCTCCTAGTATTTTGAGGGGG + Intergenic
1013962217 6:115914086-115914108 GAGTCCAGTGGAATTTAAGGTGG - Intergenic
1015469158 6:133583827-133583849 GATTCCAGAGGAATTTCAGGTGG + Intergenic
1016207562 6:141488316-141488338 GACTCCATTGGATTTGGTGGGGG - Intergenic
1016321316 6:142849218-142849240 GAGTCCATAGGAAAGAGAGGAGG + Intronic
1016512334 6:144857444-144857466 GACTCCAGATGATTCTGAGGAGG - Intergenic
1018349410 6:162941236-162941258 TAGTCCCAAGGATTTTTAGGAGG + Intronic
1018731233 6:166652703-166652725 GAGTCCTTAGTAATTTCAGGCGG + Intronic
1022219811 7:28302496-28302518 GAATTCATAGGATTTAGAGCTGG + Intronic
1027516349 7:79147134-79147156 AACTGCATAGGATTTTGACGAGG + Intronic
1028874374 7:95804259-95804281 GAGTCCATAGAAATTTGAGCAGG + Intronic
1032002787 7:128276156-128276178 GAGACCAAAGTATATTGAGGAGG + Intergenic
1034340628 7:150352343-150352365 GAGCACAGAGGATTTTTAGGAGG - Intergenic
1037038602 8:14202135-14202157 GAGTCCTTAGGATTTGAAGAGGG + Intronic
1037546100 8:19924297-19924319 TAGTCAATAGATTTTTGAGGAGG + Intronic
1038647781 8:29375312-29375334 GAGTCCATCTGCTTTTAAGGAGG + Intergenic
1042099486 8:65259260-65259282 AAGTCCATAGGACTTCGATGGGG - Intergenic
1043209407 8:77492044-77492066 TAGTCAAGAGGAGTTTGAGGAGG + Intergenic
1045139941 8:99268782-99268804 GAGAACATGGGATTTTGGGGGGG + Intronic
1045372380 8:101537492-101537514 CAGTCCATTGGACTTTGAGCTGG + Intronic
1046264066 8:111807911-111807933 GATGCCATAGTATTTGGAGGTGG - Intergenic
1050023260 9:1307106-1307128 GAGCCCTCTGGATTTTGAGGTGG + Intergenic
1050318574 9:4428104-4428126 GAGGCCATGGGAGTTTCAGGTGG + Intergenic
1052833407 9:33233429-33233451 GGGTCCATAGGATAATGGGGTGG + Intronic
1055355831 9:75436138-75436160 GAGTCCATATGACTTTTAGGAGG + Intergenic
1056753224 9:89366555-89366577 GAGTCCAAAACATTTTGAGTGGG - Intronic
1058727861 9:107820553-107820575 GACTCCAGTGGATTTTGGGGAGG + Intergenic
1058915128 9:109558149-109558171 GAGTGCATAGGAATTTGAATAGG - Intergenic
1059123190 9:111661176-111661198 GAGTTCATAGGATTTTCATGAGG - Intronic
1059730127 9:117048721-117048743 AACTACATAGGATTTTGAAGAGG - Intronic
1060047665 9:120353580-120353602 GAGTCCCTCTGATGTTGAGGGGG + Intergenic
1062151262 9:135020371-135020393 GAGTCCATAGAAGCTGGAGGAGG + Intergenic
1187324103 X:18270521-18270543 GAGTCCTTAGGAGGCTGAGGTGG - Intronic
1189087505 X:38041383-38041405 GAGTCTTTAGGCTTTTGAGAAGG - Intronic
1194130451 X:90074535-90074557 GAGCCCATAGGATTTGGTGTGGG - Intergenic
1194643940 X:96435086-96435108 GACACCAAAGGCTTTTGAGGAGG + Intergenic
1196108286 X:111919078-111919100 GTGTCCACACTATTTTGAGGAGG + Intronic
1197047199 X:122011743-122011765 GATCCCATAGGATTATGATGGGG + Intergenic
1202304396 Y:23452958-23452980 GATTCCACAGGATTTTCAAGAGG - Intergenic
1202566414 Y:26217633-26217655 GATTCCACAGGATTTTCAAGAGG + Intergenic