ID: 957138528

View in Genome Browser
Species Human (GRCh38)
Location 3:76321379-76321401
Sequence GTGGCGCGCCACTGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957138522_957138528 6 Left 957138522 3:76321350-76321372 CCTAAAAATACAAAAATTAGCTG 0: 794
1: 1252
2: 1827
3: 1552
4: 2772
Right 957138528 3:76321379-76321401 GTGGCGCGCCACTGCTCAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 74
957138520_957138528 16 Left 957138520 3:76321340-76321362 CCCTGTATCTCCTAAAAATACAA 0: 3
1: 1117
2: 70179
3: 167191
4: 187834
Right 957138528 3:76321379-76321401 GTGGCGCGCCACTGCTCAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 74
957138521_957138528 15 Left 957138521 3:76321341-76321363 CCTGTATCTCCTAAAAATACAAA 0: 8
1: 2499
2: 179072
3: 213615
4: 120044
Right 957138528 3:76321379-76321401 GTGGCGCGCCACTGCTCAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957138528 Original CRISPR GTGGCGCGCCACTGCTCAGG AGG Intronic
900624830 1:3603357-3603379 GGGGCGAGCCCCTGCTCTGGGGG - Intronic
902468402 1:16631687-16631709 CTGGCCCACCACTGATCAGGTGG + Intergenic
902842118 1:19081421-19081443 GTGGCTCTCCACTGCTCAGGGGG + Exonic
908519375 1:64926382-64926404 GTGGCTCCACACTGCCCAGGTGG + Intronic
912627002 1:111213662-111213684 CTGGCAGGCCACTGCTCATGCGG - Intronic
914914921 1:151813672-151813694 GTGGGGCTCCAGGGCTCAGGAGG - Intronic
923661126 1:235958240-235958262 GTGGCCTGCCAGCGCTCAGGAGG + Intergenic
924385568 1:243495779-243495801 GTGGCGAGCCAGAGCTCACGTGG + Intronic
1063462256 10:6222170-6222192 GAGGCACGACACTGCTCAGCAGG - Intronic
1065506478 10:26434863-26434885 CTGGCACGCCACTGCTCATGTGG + Intergenic
1065534878 10:26707107-26707129 CTGGCGGGCCACTGCGCATGCGG - Intronic
1074828223 10:117229852-117229874 GTGGTGCTCCACTGTTCAGGTGG + Intergenic
1081623202 11:44631227-44631249 ATGGCCCGCCTGTGCTCAGGAGG - Intergenic
1081631317 11:44691978-44692000 GTGGCGCGCACCTACTCGGGAGG + Intergenic
1085284415 11:75350692-75350714 CTGGCCAGCCACTCCTCAGGAGG + Intronic
1089635147 11:119807303-119807325 GTGGCGCCCCCCTCCCCAGGAGG - Intergenic
1096102965 12:48980480-48980502 GTGGCGCGCTCCTGCTCAGAAGG + Exonic
1099175095 12:79412227-79412249 GTGGCCCGCCAGTGCTTAGGAGG + Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1105696400 13:22893373-22893395 CTGGCAGGCCACTGCTCAGGTGG + Intergenic
1114037392 14:18642840-18642862 GTGGCGTGCACCTACTCAGGAGG - Intergenic
1121322772 14:93002217-93002239 GTGGTGCGCACCTACTCAGGAGG + Intronic
1121721541 14:96112318-96112340 CTGGCAGGCCACTGCTCATGAGG - Intergenic
1122611843 14:102989735-102989757 GTGGCGGGCGGCTACTCAGGAGG + Intronic
1129994219 15:79990880-79990902 GTGCAGGGCCCCTGCTCAGGAGG + Intergenic
1130019462 15:80215751-80215773 GGGGCGGGCCACTGCTGAGTTGG - Intergenic
1131093416 15:89640879-89640901 GTGGCACCCCGCTACTCAGGAGG + Intronic
1131552392 15:93368718-93368740 GTGGCGCATGCCTGCTCAGGAGG - Intergenic
1132552534 16:559478-559500 CTGGAGCCCCACTGCTCAGCTGG - Intergenic
1132726151 16:1339166-1339188 CTGGCGAGCCACTGCGCAGGGGG - Exonic
1132861633 16:2074630-2074652 GGGGAGGGCCACTGCTCGGGGGG - Intronic
1142210587 16:88806617-88806639 GAAGCTCACCACTGCTCAGGAGG + Exonic
1145017201 17:19407017-19407039 GTGGTGCACAGCTGCTCAGGAGG - Intergenic
1147174347 17:38643919-38643941 GTGGCACGTGCCTGCTCAGGAGG + Intergenic
1157517486 18:48321179-48321201 GTGGGGAACCACTGCTCAGGTGG + Intronic
1157725799 18:49962775-49962797 GGGGCTCTCCACTGCTCAGGAGG - Intronic
1161519765 19:4717297-4717319 GTGGCTCCCCACTGCCCTGGAGG - Intronic
1163150336 19:15408748-15408770 GTGGCGGGCAACTGCTCGGGAGG + Intronic
931684745 2:64783877-64783899 TTGGAGAACCACTGCTCAGGGGG + Intergenic
939936719 2:148301676-148301698 CTGGCAGGCCACTGCTCATGAGG - Intronic
941384896 2:164841233-164841255 GCGGCGCGTCACTGCTGGGGTGG + Exonic
943456189 2:188110499-188110521 GTGGTGCACAGCTGCTCAGGAGG + Intergenic
944091566 2:195917393-195917415 CTGGCAGGCCACTGCACAGGTGG + Intronic
1171011935 20:21513724-21513746 GTGGCGCTCCCCTGCCCCGGCGG + Exonic
1171290233 20:23979002-23979024 GTGCCCCTCCTCTGCTCAGGAGG - Intergenic
1175314887 20:58040265-58040287 GTGGCTCCCCAGTGCTCTGGGGG + Intergenic
1176385301 21:6136057-6136079 GAGGCCCGTCACTGCCCAGGGGG - Intergenic
1178672598 21:34604954-34604976 GTGGCACCCTGCTGCTCAGGTGG - Intronic
1179738172 21:43402195-43402217 GAGGCCCGTCACTGCCCAGGGGG + Intergenic
1180461517 22:15569888-15569910 GTGGCGTGCACCTACTCAGGAGG - Intergenic
1181401756 22:22653874-22653896 GTGCCCCTCCTCTGCTCAGGAGG + Intergenic
1181444540 22:22958842-22958864 GTGACCCCCCACTGCTCATGGGG + Intergenic
1181647797 22:24243231-24243253 GTGCCCCTCCTCTGCTCAGGAGG - Intronic
1181703712 22:24634968-24634990 GTGCCCCTCCTCTGCTCAGGAGG + Intergenic
1183524898 22:38317178-38317200 ATGCCGGGCCACTGCTCGGGGGG + Exonic
1183586382 22:38755549-38755571 CTGCCGCGCCACTGGTCAGCCGG - Intronic
1183648224 22:39138914-39138936 GTGGAGGGCAACTGCTGAGGGGG + Intronic
1183817614 22:40316526-40316548 GTGGCACACAGCTGCTCAGGAGG + Intronic
1184662259 22:45970827-45970849 CTGGGTCCCCACTGCTCAGGCGG + Intronic
951578701 3:24139503-24139525 GTGGTTCCCCACTACTCAGGAGG - Intronic
957138528 3:76321379-76321401 GTGGCGCGCCACTGCTCAGGAGG + Intronic
961627451 3:128273837-128273859 GTGCTGCCCCACTGCTGAGGTGG + Intronic
961663293 3:128481643-128481665 GTGCCTTGCCTCTGCTCAGGAGG - Intronic
962692607 3:137915320-137915342 GTGGTGCACACCTGCTCAGGAGG - Intergenic
963741720 3:149087455-149087477 GTGGCGCCCAGCTGCACAGGCGG + Intergenic
969051772 4:4378391-4378413 GTGGGGGGGCACTTCTCAGGGGG + Intronic
969859022 4:10021297-10021319 CTGGCACCCCACTCCTCAGGTGG + Exonic
970421085 4:15906142-15906164 CTGGGGCGCCACTGCTCTGCTGG + Intergenic
975139842 4:70907689-70907711 GTGGCGCTCAGCTGCTTAGGAGG + Intronic
985511034 5:314051-314073 GTGGCTCGCCTCTGCTGTGGGGG - Intronic
997980423 5:138464915-138464937 TGGGCGCGCGGCTGCTCAGGCGG - Intergenic
1013220196 6:108071425-108071447 GTGGTGCGCAGCTACTCAGGAGG - Intronic
1015522107 6:134141806-134141828 GTGGCGCACAGCTACTCAGGAGG + Intergenic
1026320607 7:69264596-69264618 GTGGCTCCCCACTGCCCATGAGG + Intergenic
1027592514 7:80134643-80134665 GGGGCGCGCCACTGCCCCGCGGG - Intronic
1037941319 8:22953083-22953105 CTGGCAGGCCACTGCGCAGGTGG - Intronic
1039523104 8:38189077-38189099 GTGGCGGGCAGCTACTCAGGAGG - Intronic
1041409767 8:57540674-57540696 CTGGCAGGCCACTGCTCATGTGG - Intergenic
1044938481 8:97315992-97316014 GTGGCACGCACCTGCTGAGGTGG + Intergenic
1045026523 8:98092294-98092316 GTGGCGCCCAGCTACTCAGGAGG - Intronic
1049328743 8:142038612-142038634 CTGGAGTGCCACTTCTCAGGTGG - Intergenic
1057869347 9:98707199-98707221 GGGTCGCGCTACTGCTCTGGTGG - Intronic
1060087460 9:120714887-120714909 CTGGCGCCCCATTGTTCAGGAGG - Intergenic
1062605940 9:137348898-137348920 CTGGGGGGTCACTGCTCAGGAGG - Intronic
1202062420 Y:20901145-20901167 GTGGCGGGCCACTTCCAAGGTGG - Intergenic