ID: 957141607

View in Genome Browser
Species Human (GRCh38)
Location 3:76366056-76366078
Sequence ATATGCAAAGGGCTGAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957141607 Original CRISPR ATATGCAAAGGGCTGAGAAA TGG (reversed) Intronic
900040494 1:458616-458638 GAATGAAAAGGGCTGAGAAGGGG + Intergenic
900061924 1:693587-693609 GAATGAAAAGGGCTGAGAAGGGG + Intergenic
901688567 1:10958257-10958279 ATATTCAAAGGGATGTGAAATGG + Intronic
905984909 1:42271288-42271310 AAATGAAAAGGGATGAAAAAAGG - Intronic
906539316 1:46572910-46572932 ACATGTAAAGGCCTGGGAAAAGG + Intronic
907840919 1:58156719-58156741 ATGTGCAAAGTGCGGAGGAAAGG + Intronic
909725869 1:78834276-78834298 ATATGCAAATGACTCAGAAATGG + Intergenic
910481585 1:87663878-87663900 ACATGAAAAGGGCAGAGAAAAGG + Intergenic
910605815 1:89082934-89082956 ATATGCCAAGGGCTAATAAATGG + Intergenic
912353274 1:109034958-109034980 ATATACAAAGGTCTGAGACCGGG + Intronic
916143403 1:161719536-161719558 ATATGTAAAGGGCTTAGAACAGG - Intergenic
916276469 1:162999445-162999467 GTAGGCAAAGGACAGAGAAAGGG - Intergenic
916558945 1:165916227-165916249 ATTGGCAAAGGGCCCAGAAATGG - Intergenic
916832799 1:168510333-168510355 ATCTGCATAGGGTTGAGAACAGG + Intergenic
917142293 1:171848205-171848227 CAATGCAAAGGGATGGGAAAAGG - Intronic
917488702 1:175478985-175479007 ATATTTAAAGGGCTTTGAAAAGG - Intronic
920380879 1:205533980-205534002 ATCTGCAAAGTGGGGAGAAAGGG - Intergenic
921400745 1:214720808-214720830 ATAAGCAAAGCTCTGAGAACAGG + Intergenic
921808669 1:219486464-219486486 GCATGCACAGGGCTGAGAAGTGG - Intergenic
922885488 1:229017356-229017378 TTATGCAAATGGATGAGAATTGG + Intergenic
922918995 1:229284541-229284563 ATCTTCACAGGGCTGAGAAGAGG - Intronic
922936609 1:229427578-229427600 ATGTGCAAAGGGTACAGAAAAGG - Intergenic
923418741 1:233791239-233791261 AGATGCCAAGTGCTGAGAACAGG + Intergenic
924735879 1:246755323-246755345 AAACTCAAAGGGCTGAGAACAGG + Intronic
1063373427 10:5537017-5537039 ATATTCAAAGGGCTGGAAATAGG - Intergenic
1064572763 10:16713008-16713030 ATATTCAAAGTGCTGAAAGAAGG - Intronic
1065028191 10:21558969-21558991 AAATGCAAAGAGCTAAGAAGTGG - Intronic
1066027497 10:31376779-31376801 ATATGGAAAGTGCATAGAAAGGG + Intronic
1066303455 10:34117144-34117166 AGCTGCCAAGGGCTGAGAAAGGG - Intronic
1067106942 10:43372905-43372927 ATATGCAGAGGGCTGGGAGGGGG + Intronic
1068193528 10:53685825-53685847 AAATGCAAAGGGATGAGGTAAGG - Intergenic
1069013633 10:63402189-63402211 ACATACAAAGGGCTAAAAAATGG + Intronic
1069479181 10:68765434-68765456 ATATACAAATGGGTGGGAAAAGG - Intronic
1069646246 10:70000239-70000261 AAGTCCAAAGGCCTGAGAAACGG + Intergenic
1070089955 10:73274943-73274965 TTTTGCAAAGAGCAGAGAAAAGG - Intronic
1070563645 10:77587289-77587311 ATATTCAGTGGCCTGAGAAAAGG - Intronic
1071706401 10:88004090-88004112 ATATGAAAAGGGATGAAAAAAGG + Intergenic
1072271593 10:93782420-93782442 AAATGCAAAGTGCTTAGAACAGG + Intronic
1072283620 10:93893063-93893085 ATGTGCAAATGTCTGAGTAAAGG + Intergenic
1072606554 10:96988446-96988468 ATATGTAAAGGGATGACTAAGGG - Intergenic
1072688659 10:97554943-97554965 ATCTACCAAGGGTTGAGAAAGGG - Intronic
1074065660 10:110010481-110010503 ATATGTAAAGTGCTTAGAATGGG + Intronic
1074258837 10:111831745-111831767 ATATGCAGAGAGATTAGAAAGGG + Intergenic
1074332800 10:112535698-112535720 CTTTGAAAAGGGCTGAGAAGAGG + Intronic
1074609086 10:115004099-115004121 ACCTGCAAAGGGCTAGGAAAGGG + Intergenic
1074609423 10:115006980-115007002 ATATGTAAAGTGCTTAGAACAGG - Intergenic
1075415467 10:122259186-122259208 ACACCCAAGGGGCTGAGAAAAGG - Intergenic
1075649008 10:124115395-124115417 CTATGCACAGGGCTTAGAACAGG - Intergenic
1075673669 10:124281418-124281440 GTATGCAGTGGGCTGGGAAATGG + Intergenic
1075937679 10:126357305-126357327 ATATTCAAAGTGCTGAGGGAGGG + Intronic
1076966767 11:94839-94861 GAATGAAAAGGGCTGAGAAGGGG + Intergenic
1077454694 11:2671468-2671490 ATACACAAAGATCTGAGAAAGGG + Intronic
1077712589 11:4551735-4551757 ATAAGCAGAGTGCTGGGAAAAGG - Intergenic
1078008449 11:7550395-7550417 AAAAGCAAATGCCTGAGAAAGGG - Intronic
1078524198 11:12088177-12088199 ATATTCAAAGGGTGGGGAAATGG - Intergenic
1078582169 11:12547134-12547156 ATTTACAGAGGGCTGAGAAGGGG - Intergenic
1079944086 11:26719619-26719641 AGATGCAAAGGCCCTAGAAAAGG - Intronic
1080407235 11:31990357-31990379 ATATGCAAAGTGTTTAGCAAAGG - Intronic
1080475393 11:32585154-32585176 AAATGCAAAAGGCGGAGAAAAGG + Intronic
1082189009 11:49219274-49219296 ATAGTCACAGTGCTGAGAAAAGG - Intergenic
1082891769 11:58146791-58146813 AAATGCAAAGGTCTGTGAAATGG + Intronic
1085089092 11:73694453-73694475 ATATGGAAAGCACTGTGAAAGGG + Intronic
1085553373 11:77396130-77396152 ATAGTAAAAGGACTGAGAAATGG - Intronic
1087265085 11:96051769-96051791 ATAGGCAAAGAGCAGAAAAAGGG + Intronic
1087514113 11:99135384-99135406 CCATGTAAAAGGCTGAGAAAGGG + Intronic
1087589821 11:100173211-100173233 ATATGTAAAGGGGTGAGGAATGG - Intronic
1087909473 11:103736603-103736625 CTCTGCAAAGGACTGAGCAATGG - Intergenic
1089249900 11:117151049-117151071 AAATGCAAAGGACTATGAAAAGG - Intronic
1089381847 11:118038838-118038860 ATGTGCAAAGGGCTCAAAACAGG + Intergenic
1090186540 11:124742759-124742781 ATATGCAAAGCGCTTAGCACAGG + Intronic
1091502152 12:1028713-1028735 ATTTGGAAAGGGCTGAGAAATGG - Intronic
1093548666 12:20379536-20379558 AAATGCTTATGGCTGAGAAAAGG - Intronic
1093965974 12:25325716-25325738 ACATCCAAAGCTCTGAGAAATGG - Intergenic
1094214925 12:27930752-27930774 GTGAGGAAAGGGCTGAGAAAGGG - Intergenic
1094644463 12:32308458-32308480 ATATGCAGAGTGCTGAGAACAGG + Intronic
1097345090 12:58482618-58482640 ACATGCAAGGGGATGAAAAAAGG + Intergenic
1098921426 12:76305699-76305721 AAATGCAAAAGGCTGTCAAAAGG - Intergenic
1099889385 12:88572246-88572268 AAATGCAAACGGCTTAGAACAGG + Intronic
1100690150 12:97031018-97031040 ATATGCAAATTGCTTAGAACAGG + Intergenic
1100779245 12:98006939-98006961 ATAAGCCATGGGCTGAGAGATGG + Intergenic
1101368613 12:104101933-104101955 ATATGCAAAAGTCAAAGAAAAGG - Intronic
1102413508 12:112740518-112740540 CTATGCATGGTGCTGAGAAAAGG - Intronic
1102599460 12:114018088-114018110 AGATGCAAGGGGATGAGAATGGG + Intergenic
1102718692 12:114997562-114997584 ATATGGAATGGGATGTGAAAGGG - Intergenic
1106116082 13:26818985-26819007 ATATGCTGAGGTCTGAGCAAGGG + Intergenic
1106387220 13:29299534-29299556 TTATGCTAAGTGCTGTGAAAGGG + Intronic
1107145977 13:37060615-37060637 ATTTGCCAGGGGCTGAGAGAGGG - Intergenic
1107340310 13:39398472-39398494 TTCTGCAAAGGGCAGAGCAATGG + Intronic
1108072551 13:46643128-46643150 ATGGGCAAGGGGCTGTGAAAAGG - Intronic
1108146343 13:47481214-47481236 AAATGCATAGGGAAGAGAAAGGG + Intergenic
1109492545 13:63121673-63121695 ATTAGCCAAGGGCTGAGAGAAGG + Intergenic
1109961922 13:69643085-69643107 ATATGCAATGGGTTGTAAAATGG - Intergenic
1111696014 13:91625137-91625159 ACATGCTAAGGAATGAGAAAGGG + Intronic
1111944280 13:94647490-94647512 AGATACAAAGGAATGAGAAAGGG + Intergenic
1113337956 13:109394807-109394829 ATATGCAAAGTTCAGAGAGATGG - Intergenic
1115414755 14:33119362-33119384 ATATTAAAAGAGCTGTGAAAGGG - Intronic
1116492343 14:45519791-45519813 ATATGCAAAGGCCTGATGAATGG - Intergenic
1117223753 14:53633963-53633985 ATATCATAAGGGCTGACAAATGG + Intergenic
1118321906 14:64758250-64758272 AGATGCTCAGGACTGAGAAATGG + Intronic
1118399532 14:65366957-65366979 AAAAGCGAAGAGCTGAGAAAGGG + Intergenic
1118891771 14:69915929-69915951 ATAAGCAAAGGAATGAGAATAGG - Intronic
1119011173 14:70990722-70990744 AAAAACAAAGGGCTCAGAAAAGG - Intronic
1119414870 14:74463170-74463192 ATATGATAAGGACTGAGAAGTGG - Intergenic
1120143889 14:80958191-80958213 TCATGCAAAGCGCTGAGAACAGG - Intronic
1120211450 14:81637775-81637797 ATATTCAAAGGGGTCAGAAATGG + Intergenic
1120943774 14:89974652-89974674 ATATGTAAAATGCTGAGCAACGG - Intronic
1121564888 14:94901798-94901820 ACATGCAAAGGTCTGGGAACTGG + Intergenic
1121699737 14:95943578-95943600 GTGTGGAAAGGGCTGAGCAAGGG + Intergenic
1124050452 15:26192340-26192362 AAATGCAAAAGGCCGTGAAAAGG - Intergenic
1124169874 15:27363276-27363298 ATATGTTAAGGGGTCAGAAATGG + Intronic
1124835363 15:33191633-33191655 AAAAGCAAGGGTCTGAGAAATGG - Intronic
1125023310 15:35006145-35006167 AGATGCAAAGAGATGAGAAGAGG + Intergenic
1125254865 15:37751986-37752008 ATATTCAAAGGGATGATAAAAGG - Intergenic
1125344054 15:38701019-38701041 ATATACAAAGGTATGAGACATGG + Intergenic
1125826273 15:42679124-42679146 AGATGCAAGAGGCTGAGACAGGG - Intronic
1126399252 15:48252551-48252573 ATGAGCAAATTGCTGAGAAAAGG + Intronic
1126538506 15:49795548-49795570 ATATGGAAAGGGCAGAGTCACGG + Intergenic
1126876195 15:53044668-53044690 ACGTGCAAAGAGCTGAGGAAGGG - Intergenic
1127197971 15:56610576-56610598 ATCTTCAAAGAGCAGAGAAAAGG - Intergenic
1128186371 15:65646435-65646457 ATATGAAAATGGAGGAGAAAAGG - Intronic
1130444206 15:83983610-83983632 AAATGCCAAGTGCTGAGTAAAGG - Intronic
1130693397 15:86105630-86105652 ATAGAAAAAGGGCTGAGTAAAGG - Intergenic
1130757472 15:86780441-86780463 AAATGCAAATGGCCAAGAAAAGG - Intronic
1131321541 15:91397937-91397959 GAAAGTAAAGGGCTGAGAAAAGG - Intergenic
1132215654 15:100059837-100059859 TTATGCATAGGGCTGTGGAAAGG - Intronic
1132441412 15:101869007-101869029 GAATGAAAAGGGCTGAGAAGGGG - Intergenic
1133458300 16:5962639-5962661 ATATGTAAAGCACTGAGAAATGG + Intergenic
1134164731 16:11920838-11920860 AGATGCACAGGGCTGGGAAGGGG + Intergenic
1134436194 16:14259923-14259945 ATGTGCAAATGGCTGAGAGAAGG - Intronic
1134502362 16:14779269-14779291 CTATGGAAATGGATGAGAAAAGG + Intronic
1134578200 16:15349625-15349647 CTATGGAAATGGATGAGAAAAGG - Intergenic
1134724391 16:16407921-16407943 CTATGGAAATGGATGAGAAAAGG + Intergenic
1134862289 16:17571291-17571313 ATATGCAACGGTCTCAGAACAGG - Intergenic
1134943040 16:18303938-18303960 CTATGGAAATGGATGAGAAAAGG - Intergenic
1135190591 16:20351046-20351068 ATGTGCAATGTGCTGAGAATTGG - Intronic
1135200636 16:20434887-20434909 ATGAGCAAAGGGCTAAGAATAGG - Intronic
1135460947 16:22642477-22642499 AGCTGCAAAGTGCAGAGAAAAGG + Intergenic
1135614183 16:23896688-23896710 ATATGCAAAGGGCTTGAAAGGGG + Intronic
1136646736 16:31625938-31625960 ATATTCAAAGTGCTGAAAGAAGG + Intergenic
1136751815 16:32643898-32643920 ATGTACAAAGGGCAGAGAAGAGG - Intergenic
1136933860 16:34440764-34440786 TTATGTAAAGGGCTGGCAAAGGG - Intergenic
1136970712 16:34971050-34971072 TTATGTAAAGGGCTGGCAAAGGG + Intergenic
1137339880 16:47591228-47591250 ACAGGGAAAGGGCTGAGGAAGGG - Intronic
1139000509 16:62504874-62504896 TTCTGAAAAGGGCTCAGAAACGG + Intergenic
1139011515 16:62640420-62640442 ATGTGAAAAGGGCTCAGGAAAGG - Intergenic
1139055865 16:63182847-63182869 AAATGCAAATGGAAGAGAAATGG - Intergenic
1139259652 16:65579360-65579382 ATCTGCAAAGAGCTGACAAAAGG + Intergenic
1140016628 16:71193044-71193066 ATATGCAAAGGACAGAGTTATGG - Intronic
1140609479 16:76581122-76581144 ATGTACAAAGAGATGAGAAAGGG - Intronic
1140939559 16:79708522-79708544 ATAGTCCAAGTGCTGAGAAATGG - Intergenic
1141195987 16:81861713-81861735 ATTGGCACAGGGCTGAGAGAGGG + Intronic
1142455691 16:90220352-90220374 ACATGCAAAGGGCCAAGTAAGGG + Intergenic
1203053951 16_KI270728v1_random:903152-903174 ATGTACAAAGGGCAGAGAAGAGG - Intergenic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1145839688 17:27984143-27984165 ATATGTACAGAGCTGAGATAGGG + Intergenic
1146059106 17:29595270-29595292 ATGTGCAAAGCGCTAAGACATGG + Intronic
1146250991 17:31344214-31344236 ATATAGAAAGGGGTGAGAATAGG - Intronic
1146730803 17:35193014-35193036 AGATCCAAAGGGCTGAGGCAGGG - Exonic
1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG + Intronic
1149536501 17:57437670-57437692 ATAAGGAGAGGGATGAGAAAAGG + Intronic
1149630013 17:58114908-58114930 AGATCCAAGGGGTTGAGAAATGG + Intergenic
1150856273 17:68756189-68756211 ATATGCAAAGGTCTAAGCACAGG + Intergenic
1151224356 17:72637808-72637830 AAAGGCAAAGGTCAGAGAAAGGG + Intergenic
1151254400 17:72864476-72864498 ATAAGCCATGGGCTGTGAAAGGG + Intronic
1151296394 17:73189565-73189587 ATATGCAGAAGGCAGAGGAAGGG + Intergenic
1151749205 17:76027176-76027198 ATGTTCAAGGGGCTGAGCAAAGG - Exonic
1152044671 17:77928101-77928123 AGAAGGAAAGGGCTTAGAAAGGG + Intergenic
1152206934 17:78979243-78979265 AAATGCACAGGTCTGAGAGAGGG + Intronic
1203161919 17_GL000205v2_random:60598-60620 ATTTGTAAAGGGCTGAACAAAGG - Intergenic
1152985668 18:318401-318423 ATATGAAAAGGGCTGAAACTAGG - Intergenic
1153567427 18:6432395-6432417 CTATGCAAAGTGCTGAAAGAGGG - Intergenic
1154054963 18:11004018-11004040 TTCTGCAAAGGCCTGAGAAGGGG + Intronic
1155190019 18:23421588-23421610 AGAAGGAAAGGTCTGAGAAATGG - Intronic
1155421873 18:25664967-25664989 ATAAGCAAAGGGCCAGGAAAAGG - Intergenic
1155423819 18:25685083-25685105 CCAAGCAAAGGGCTGAGGAAAGG + Intergenic
1155661661 18:28256371-28256393 ATGTGCAATGGGATGAGTAATGG + Intergenic
1159107011 18:64014300-64014322 ATAAGCAAAGGACTGAAAAGAGG + Intergenic
1159187093 18:64989008-64989030 TTATGCAAAAGGCTGTGACAGGG - Intergenic
1159442369 18:68497919-68497941 ATCTCCAAGGGGCAGAGAAAGGG - Intergenic
1159764636 18:72473459-72473481 AAAGTCATAGGGCTGAGAAATGG + Intergenic
1159854643 18:73570043-73570065 AGAAGAAAAAGGCTGAGAAATGG + Intergenic
1160643570 19:164462-164484 GAATGAAAAGGGCTGAGAAGGGG + Intergenic
1162823992 19:13239691-13239713 GTGTGCAAGGGGCTGAGAAGTGG + Intronic
1164051929 19:21591184-21591206 CATTGCAAAGAGCTGAGAAAGGG - Intergenic
1164125683 19:22314407-22314429 GTTTTCTAAGGGCTGAGAAATGG - Exonic
1164125766 19:22315415-22315437 GTCTTCTAAGGGCTGAGAAATGG - Exonic
1164125772 19:22315499-22315521 GTCTTCTAAGGGCTGAGAAATGG - Exonic
1164174468 19:22757826-22757848 GTTTCCTAAGGGCTGAGAAATGG + Exonic
1164174553 19:22758918-22758940 GTTTTCTAAGGGCTGAGAAATGG + Exonic
1164472290 19:28546369-28546391 CTCTGCACAGGGCTGATAAAGGG + Intergenic
1164715258 19:30386123-30386145 GTAGGCAAAGGGCTGAGGGATGG - Intronic
1164856127 19:31525144-31525166 ATAAGCAAGGGGTTGGGAAAAGG - Intergenic
1164915208 19:32046573-32046595 ATAAGAAAATGGCTGAGAAGTGG + Intergenic
1165914441 19:39248883-39248905 TTATGCGCAGGGCTGAGAATGGG + Intergenic
1167921799 19:52788188-52788210 AGATGACAAGGACTGAGAAAAGG + Intronic
1167932043 19:52873844-52873866 AGATGACAAGGACTGAGAAAAGG + Intronic
1168451517 19:56470121-56470143 ATCTGCAAAGGGAGGACAAAGGG + Intronic
925370877 2:3344525-3344547 ATATACAAAGAGCCCAGAAAGGG - Intronic
925669972 2:6300983-6301005 ATGTGCTTTGGGCTGAGAAATGG + Intergenic
925843696 2:8016901-8016923 CTATGAGAAGGTCTGAGAAAAGG + Intergenic
925926291 2:8673209-8673231 ACATGGAAAGGGCTAAAAAAGGG - Intergenic
926641920 2:15246215-15246237 ACAGGCAAAGGCCTAAGAAAGGG - Intronic
927490261 2:23516692-23516714 ATAGGCAAGGGGCTGGGAAGTGG + Intronic
927691670 2:25212919-25212941 ACATCCAAAGGGCAGAGAGAGGG - Intergenic
929285430 2:40130159-40130181 AGATGCAAAGAGCTTTGAAATGG + Intronic
929317947 2:40503225-40503247 ATATGCAAAGTCTAGAGAAAAGG - Intronic
929432107 2:41895925-41895947 AGATGCAGAGGGCTGGGATATGG - Intergenic
929469386 2:42176247-42176269 AAAAGAAAAGGGATGAGAAAAGG - Intronic
930127388 2:47812427-47812449 ATTTGCAAGGTGTTGAGAAATGG - Intronic
930340772 2:50111713-50111735 ATATTCAAAGGGCTGTGATTTGG - Intronic
931062515 2:58547095-58547117 AAATGCAAAAAGCTGAGAAGAGG - Intergenic
932202401 2:69842835-69842857 ATTTGCAAAGGTCTCAGACAGGG + Intronic
932738811 2:74275927-74275949 ATGTGCAAAGTGGTGAGAACAGG - Intronic
934962574 2:98690042-98690064 CTATGCAAAGGACTCAGTAAAGG + Intronic
935188890 2:100759895-100759917 AGTTGCAGAGGGCTGAGAAGGGG - Intergenic
935438592 2:103064826-103064848 ATGTGGAAAGGGCTTACAAATGG + Intergenic
935452793 2:103229652-103229674 ATATTCAATGGGCTGTGCAAAGG - Intergenic
937312005 2:120908398-120908420 ATATGCAAGGGGCTTGGGAAAGG - Intronic
937535014 2:122875463-122875485 ATATACAAAGTGGTGAGAAGTGG - Intergenic
937897764 2:126991410-126991432 CTACCCAAAGGGCTGGGAAAAGG - Intergenic
938639059 2:133261085-133261107 ATGAGCAAAGAACTGAGAAATGG + Intronic
939675090 2:145062659-145062681 AAATTCAAAGGCCTGAGAACTGG + Intergenic
940277639 2:151956079-151956101 ATATGGAAATAGCTGAGATATGG + Intronic
940897946 2:159098953-159098975 ATGTGCCTAGGGCTGTGAAATGG + Intronic
941003989 2:160228490-160228512 ATATGAAAAGACCTGAGAAAGGG + Intronic
941728059 2:168885899-168885921 ATATGCAAAGAGCTTAGAACAGG + Intronic
943344717 2:186724848-186724870 AGATGCAGTGGGCTCAGAAAAGG + Intronic
943810070 2:192174370-192174392 AAATGAAAAGGGAGGAGAAAGGG - Intronic
943878887 2:193112984-193113006 TTAGCCAAAGGGCTGAGAAAAGG + Intergenic
944514074 2:200493723-200493745 AAATGCAAAGTGCTTAGAACAGG + Intronic
945159061 2:206870384-206870406 ATATTTAAAGTGCTGAGAATAGG - Intergenic
945229133 2:207565843-207565865 CTATGAAAAGGCCTGAGGAAAGG - Intronic
947108769 2:226696267-226696289 ATATGCAAAGGGCTAGCAAAAGG + Intergenic
947124361 2:226851805-226851827 AAAGGCAAAAGGCTGAGGAAGGG - Intronic
947483177 2:230521972-230521994 AAACCCAAATGGCTGAGAAAGGG + Intronic
947695458 2:232183604-232183626 ATCTATAAAGGGCTGTGAAAAGG - Intronic
947744707 2:232501571-232501593 ATATGCAAAGTGCTTAGCACAGG - Intergenic
949087187 2:242165153-242165175 AAATGCAAAGGGCCAAGTAAGGG + Intergenic
1169773517 20:9227104-9227126 ATGGGCAAAGGGCAGAGAAGAGG - Intronic
1169871603 20:10254111-10254133 CTATGCAATGGGCTGGTAAAAGG - Intronic
1170006337 20:11673626-11673648 ATATGATAAGGGGTAAGAAAGGG - Intergenic
1170236748 20:14114934-14114956 AAATGCCAAGGACTCAGAAAAGG - Intronic
1172399576 20:34638182-34638204 AAATGCAAAGGTGTGGGAAAAGG - Intronic
1172973926 20:38892850-38892872 ATGTGCAAAGCCTTGAGAAAGGG + Intronic
1173637526 20:44573753-44573775 ATATGTAAAGCACTGACAAATGG + Intronic
1174098646 20:48109694-48109716 ATATGCAAAGAGTTTAGAAAAGG + Intergenic
1174331551 20:49823391-49823413 AGAAGCAAAAGGCTAAGAAAGGG - Intronic
1176999956 21:15599978-15600000 ATATATAAAGAGTTGAGAAATGG + Intergenic
1177587797 21:23120638-23120660 AAAGGGAAAGGCCTGAGAAAAGG + Intergenic
1177692154 21:24524816-24524838 ATATACAGAAGGCTGAAAAATGG + Intergenic
1177906282 21:26974675-26974697 ATATGCAAAGGACTGAGCTAGGG - Intergenic
1178817391 21:35944304-35944326 ATATGCTAAGCGCTTAGAACAGG - Intronic
1179557123 21:42186865-42186887 ATTTGCTGAGGGCTCAGAAAGGG - Intergenic
1181421495 22:22802380-22802402 ATAAGCATAGGGCTGAGGAAGGG + Intronic
1182160216 22:28114150-28114172 AGAGCCAAATGGCTGAGAAATGG + Intronic
1182503791 22:30767677-30767699 GAATGCAGAGGGCTGAGAAAGGG + Intronic
1182763394 22:32741048-32741070 ATTTCCAGATGGCTGAGAAAAGG + Intronic
1183376932 22:37470894-37470916 ATATGCAAAGGCCTGATAGCAGG - Intronic
1183544963 22:38450561-38450583 GAATGCAGAGGGCTGAGAGAGGG - Intronic
1183700209 22:39446763-39446785 AGATGCAAAGTGCTTAGAACGGG - Intergenic
1184833768 22:47008314-47008336 GAATGGAGAGGGCTGAGAAAAGG - Intronic
949448285 3:4159680-4159702 ATCTGAAAAGGGTTAAGAAAAGG - Intronic
949686429 3:6576943-6576965 ATATTTAAGGGGCTGAGAGAAGG + Intergenic
949903044 3:8835750-8835772 AGAGGCCAGGGGCTGAGAAAAGG + Intronic
951359798 3:21711841-21711863 ATATGCAAAAGGTAGAAAAATGG - Intronic
952004148 3:28822832-28822854 ATGTCCAAAGGCATGAGAAAAGG + Intergenic
954477568 3:50762495-50762517 ATATATAAAGAGTTGAGAAATGG + Intronic
954635913 3:52070773-52070795 AGAAGCCTAGGGCTGAGAAAAGG + Intergenic
954737136 3:52715838-52715860 ACATGCAACGTGGTGAGAAAGGG - Intronic
955388211 3:58497102-58497124 ACATGCTATGGGGTGAGAAATGG - Intronic
957141607 3:76366056-76366078 ATATGCAAAGGGCTGAGAAATGG - Intronic
957439396 3:80224394-80224416 ATGTCCAAAGGGAGGAGAAAAGG - Intergenic
959145066 3:102534413-102534435 ATATCAAAAGTGCTAAGAAAAGG - Intergenic
959597918 3:108147851-108147873 ATATACAAAGGGCTGTGCCAGGG - Intergenic
960031649 3:113060217-113060239 AAATGGAAAGACCTGAGAAAAGG - Intergenic
962398532 3:135038256-135038278 AGATTCAAAGGGAGGAGAAATGG - Intronic
963749450 3:149160854-149160876 ATATGCAAGGAGCTTAGAATAGG - Intronic
964411800 3:156405415-156405437 AAATGCAATGGGATGAGACAGGG - Intronic
965447732 3:168796505-168796527 ATATGTGAAGAACTGAGAAAAGG - Intergenic
966564086 3:181356771-181356793 ATATTCAAAGGGCTCAGAGAAGG + Intergenic
967493834 3:190121438-190121460 AAATGCATAGAGCTGAGAAGTGG + Intronic
969247142 4:5942599-5942621 ATATGTAAAGTGCTTAGAACAGG - Intronic
970154302 4:13126118-13126140 ATATACAAAGTGCTTAGAAGAGG + Intergenic
970818168 4:20182538-20182560 AGCTGCAAAGGAGTGAGAAAAGG - Intergenic
970916404 4:21340872-21340894 ATGTGCATAGGGCAGATAAAAGG + Intronic
971256603 4:25019771-25019793 ATGTGCAGAGGCCTGAGAAGTGG - Intronic
972459467 4:39287324-39287346 ATATCCAAAAGGCATAGAAATGG + Intergenic
975072975 4:70166285-70166307 ACTTGCAAAGGTCTGAGATAAGG - Intronic
975343314 4:73265551-73265573 ATATGCAAAAGGCCTAAAAAAGG + Intergenic
976396747 4:84564228-84564250 ATATGCAAAGCTCTGGGAAAAGG + Intergenic
978304986 4:107317798-107317820 ATATGATAAGAGGTGAGAAAGGG - Intergenic
979212006 4:118116023-118116045 ATATGCAAACTGCTGTGAGAAGG + Intronic
979440886 4:120748749-120748771 ATCTAGAAAGGGATGAGAAATGG + Intronic
979799756 4:124894244-124894266 CTAGCCAAAGGACTGAGAAAGGG + Intergenic
980607860 4:135116385-135116407 GTATGCACAGGGCTGGGAAGTGG - Intergenic
981342440 4:143637497-143637519 TTAAGCAAAAGCCTGAGAAATGG - Intronic
981664649 4:147209453-147209475 AAATGCAAATGGCTGCGAATAGG - Intergenic
982076375 4:151741433-151741455 ATATGCACATGGATGAGATATGG - Intronic
982256395 4:153455471-153455493 ATATGCAAAGCACTTAGGAAAGG + Intergenic
984896352 4:184544582-184544604 ATGTTTAAAAGGCTGAGAAATGG + Intergenic
987037609 5:14033971-14033993 ATAAGCAACAGGCAGAGAAATGG + Intergenic
988317968 5:29656177-29656199 ATATACACAGGGCAAAGAAAAGG + Intergenic
988891433 5:35621300-35621322 CTATGTAAAGGGCTTAGAACAGG - Intronic
990194996 5:53304896-53304918 ATATGCAAAATGCTGTGGAAGGG + Intergenic
991923391 5:71680066-71680088 ATATGCAAAGGCTTGAAAAAGGG - Intergenic
993288108 5:86027943-86027965 ATATGCTAAGGACTGGGAGATGG + Intergenic
994281550 5:97909430-97909452 TTCTGGAAAGGGGTGAGAAATGG + Intergenic
994601867 5:101915600-101915622 CTTTGCTAAGGACTGAGAAAAGG - Intergenic
996366185 5:122703688-122703710 ATATGCAAAGAGCAGTGAACTGG + Intergenic
997716115 5:136044272-136044294 CTATGCGAGGGGCTGAGGAATGG + Intronic
999529231 5:152443832-152443854 ATATGCACAGGCCTGACAGAAGG - Intergenic
999864135 5:155682496-155682518 ATATTCAAAGGGCTAAAACAAGG - Intergenic
999897484 5:156051027-156051049 ATATGTGAAAGGCTGAGTAATGG - Intronic
1001205689 5:169760805-169760827 ACAGGCAAAGCGCAGAGAAATGG - Intronic
1001252442 5:170157210-170157232 CAAAGCAAATGGCTGAGAAATGG - Intergenic
1001557525 5:172646831-172646853 ATGTGCAAAGGCCTGAGGGAGGG + Intronic
1001595259 5:172894623-172894645 AGAGGCAAAGCCCTGAGAAAAGG - Intronic
1001850152 5:174956675-174956697 ATAGGAAAAGGGCTCAAAAAGGG - Intergenic
1002160335 5:177311046-177311068 ATATGCAAAGGGCTGGGGAGAGG + Intronic
1002733353 5:181360329-181360351 GAATGAAAAGGGCTGAGAAGGGG - Intergenic
1002751188 6:113789-113811 GAATGAAAAGGGCTGAGAAGGGG + Intergenic
1002823240 6:748733-748755 ATAGGCAAAGTGCTGGGAGAAGG + Intergenic
1004009368 6:11667335-11667357 TTATGCAAAGAGCATAGAAAAGG - Intergenic
1004121313 6:12824975-12824997 ATATTTAAAGTGCTTAGAAAAGG + Intronic
1005263012 6:24082086-24082108 ATTTGCAAAGGGAACAGAAAGGG + Intergenic
1005486295 6:26303421-26303443 TTAGGCAAAGGGCTTAGATATGG + Intergenic
1007409089 6:41651445-41651467 ATGCGCACAGAGCTGAGAAATGG + Intronic
1007413511 6:41678768-41678790 GTGTGCAAAGGCCTGACAAAGGG - Intergenic
1008385648 6:50886821-50886843 ATATGCAAGTGGCCAAGAAATGG - Intergenic
1008783370 6:55135647-55135669 ATATGTAAAGTGTTTAGAAAGGG - Intronic
1009959949 6:70507100-70507122 ATCTGGAATGGGGTGAGAAAAGG - Intronic
1011384792 6:86783496-86783518 ATATGCAAAAGGTAGGGAAATGG + Intergenic
1012122434 6:95384866-95384888 ATCTGCAAGGTGCTGAGCAAGGG - Intergenic
1012184884 6:96200452-96200474 ATCTGTGAAGGGATGAGAAAAGG + Intronic
1013195517 6:107841646-107841668 ATATGCAAAGTGCTTAGAACAGG + Intergenic
1013307437 6:108862632-108862654 ATTGGCAAAGGGCAGAGATAGGG + Intronic
1014600334 6:123403513-123403535 ATATGGAAAAGTCTGGGAAATGG + Intronic
1014694095 6:124597003-124597025 AGAACCAAAAGGCTGAGAAAGGG - Intronic
1015364351 6:132380382-132380404 AAAAGCAAAGAGCTGGGAAAAGG - Intronic
1017557840 6:155591818-155591840 ATATCCAAAAGGTTGAGATAAGG + Intergenic
1018079617 6:160247582-160247604 CTTTGCAAAGGCCTGAGAACTGG + Intronic
1019237603 6:170632651-170632673 GAATGAAAAGGGCTGAGAAGGGG - Intergenic
1019866773 7:3719164-3719186 ATTTACAAAATGCTGAGAAATGG + Intronic
1020360651 7:7323494-7323516 TCATGCAAAGAGCTGTGAAAGGG + Intergenic
1020679351 7:11217833-11217855 ATAAACAAAGGGCTATGAAAAGG + Intergenic
1021955678 7:25822305-25822327 ATATGTAAAGTGCTTAGAAGAGG - Intergenic
1022053928 7:26709321-26709343 ATAAGCAGTGGTCTGAGAAAAGG + Intronic
1023126499 7:36959537-36959559 AGAGGCAGAGGGGTGAGAAATGG - Intronic
1024680729 7:51684158-51684180 ACATGCAAAGGGCTAGCAAACGG - Intergenic
1025213209 7:57033179-57033201 AAGTGCAAGGGGCTGACAAATGG - Intergenic
1025658744 7:63543645-63543667 AAGTGCAAGGGGCTGACAAATGG + Intergenic
1027391445 7:77707876-77707898 ATATGTAAAGTGCTGAGTACAGG - Intronic
1028287869 7:89026355-89026377 ATATACAAAGAGCTGGGACACGG + Intronic
1028428274 7:90715899-90715921 ATAGCCAAAGGGCTCAGAAATGG - Intronic
1030823898 7:114130742-114130764 ATATGCAAAGGCATCAGAATAGG + Intronic
1031735720 7:125358358-125358380 AGTTTCAAATGGCTGAGAAAGGG - Intergenic
1033205109 7:139413345-139413367 ATTTGGAAAAGACTGAGAAAGGG - Intronic
1033979350 7:147145106-147145128 ATATGCAAATGTTTGAGAAGAGG - Intronic
1035497538 8:66187-66209 AAATGCAAAGGGCCAAGTAAGGG - Intergenic
1035510165 8:173960-173982 GAATGAAAAGGGCTGAGAAGGGG + Intergenic
1035963777 8:4167587-4167609 ATATGCAAATGGCAGAAAAAAGG + Intronic
1036392736 8:8338475-8338497 TTATACAATGGGCTGGGAAAAGG + Intronic
1037455154 8:19055641-19055663 ATAGGCAAAAGGTTTAGAAAGGG + Intronic
1037898635 8:22674808-22674830 AACTGCAAAGGGCAGAGAACGGG - Intergenic
1038433093 8:27515549-27515571 ACATGAAAATGGCTGAGAAGAGG - Intronic
1038916499 8:32030509-32030531 ATATGAAAGAGGCTGAGGAAAGG - Intronic
1039474909 8:37834550-37834572 CGATGCAAAGGGGTGAGACATGG + Intronic
1040936058 8:52783263-52783285 TTATTCAAAGGGGTGAGAAGTGG + Intergenic
1041335296 8:56775313-56775335 AAAAGCAAAGGTCTGAGAAATGG + Intergenic
1041361879 8:57063609-57063631 ATATGTAAAGGGCTTAGATTAGG - Intergenic
1042748032 8:72128458-72128480 ATATGAAAAAGGCCTAGAAAGGG - Intergenic
1043347703 8:79319240-79319262 ATACGCAAAGGGCTTAGGACAGG - Intergenic
1043928979 8:86069281-86069303 ATCTCAAAAGGGCAGAGAAAGGG + Intronic
1044218917 8:89646817-89646839 AGCTGAAAAGGGCTGGGAAATGG + Intergenic
1044580739 8:93823526-93823548 GTCTGCAAAGGCCTGTGAAAGGG + Intergenic
1044627471 8:94248175-94248197 AGATGCAAAGTGCAGAGAGATGG + Intergenic
1045047113 8:98289804-98289826 ATAATCAAAGGGCTGAGTAGAGG - Intronic
1045593410 8:103625129-103625151 ATATGTAAAGGGCTGGGGCAGGG + Intronic
1045790258 8:105975800-105975822 ATACTCAAAGGGCAGAGAGAGGG + Intergenic
1046090713 8:109500059-109500081 ATATTCAAAGAGATGAGAGATGG + Intronic
1046604968 8:116361300-116361322 ACATGAAAGGGGCTGAGAACTGG + Intergenic
1046696218 8:117342643-117342665 ATAGGAAAAGGGATAAGAAAAGG + Intergenic
1047089595 8:121558878-121558900 ATAGGCAGAGTGCTGAGAAACGG + Intergenic
1050065888 9:1759163-1759185 AGATGCAGAGGCCTGGGAAAGGG + Intergenic
1050564088 9:6864295-6864317 ATTTTCAAAGTGCTGAAAAATGG - Intronic
1051351629 9:16203323-16203345 TTCTGCAAGAGGCTGAGAAATGG - Intergenic
1051636928 9:19189155-19189177 ATAGGCAAAAGGAAGAGAAAAGG - Intergenic
1051884065 9:21871431-21871453 GTTTGCAAAGTGCAGAGAAAGGG - Intronic
1052112070 9:24598537-24598559 TTAGTCAAAAGGCTGAGAAAAGG - Intergenic
1053330466 9:37201742-37201764 ATGTGAAAAGGGCAGAGTAATGG + Intronic
1054749186 9:68886970-68886992 AAATGCAAAGGCCTGAGATGTGG - Intronic
1054765385 9:69038351-69038373 AGATGCAAGGGGTGGAGAAAAGG - Intronic
1055763334 9:79633586-79633608 TTATGCAGAGGTCTGAGGAATGG + Intronic
1055887757 9:81084774-81084796 AAATGGAAAGGATTGAGAAAAGG - Intergenic
1056107768 9:83364089-83364111 ATATGCAAAAGACTCAGAGAAGG - Intronic
1056499494 9:87194294-87194316 AAAAGCAAAGGGCTGGGAAAAGG - Intergenic
1058807968 9:108610986-108611008 TTCTTCAAAGGGCTGAGCAAGGG + Intergenic
1060033375 9:120234446-120234468 ATAGGCAAAGGGGAGAGAGATGG + Intergenic
1060070503 9:120542913-120542935 CTTTACAAAGGGCTGAGCAATGG + Intronic
1060418069 9:123446859-123446881 CTTTACAAAGGGCTGTGAAATGG + Intronic
1061715216 9:132514547-132514569 AAATGGAAAGGGCTGAGAACAGG - Intronic
1062476941 9:136732943-136732965 AAATGCAGAGGGCTGTGAAGTGG + Intergenic
1062757757 9:138312641-138312663 GAATGAAAAGGGCTGAGAAGGGG - Intergenic
1185682907 X:1903181-1903203 ATCCGCAGAGTGCTGAGAAAGGG - Intergenic
1186398488 X:9234583-9234605 AAAAGCAAAGGGCAAAGAAAAGG - Intergenic
1187553092 X:20325724-20325746 AGCTGCAAAGGGCTGATAAAAGG - Intergenic
1188665940 X:32821028-32821050 ATATGGAACGGGCTGAAAATCGG + Intronic
1189670632 X:43404680-43404702 CTGTGCAAAGGGCTGAGGAAGGG + Intergenic
1190366485 X:49699242-49699264 ATATGCTAAGGGTTTAGGAAAGG - Intergenic
1190542364 X:51490678-51490700 GAATGCAGAGGGCTGAGAGAGGG - Exonic
1191792414 X:64984845-64984867 ATATGCACAGGCATGAGCAAGGG + Intronic
1192815917 X:74591986-74592008 ATATGGAAAGGGCAGAGTCACGG - Exonic
1195287259 X:103397159-103397181 AGCTGCAAAGGGCTGTGGAAAGG - Intergenic
1195706554 X:107741845-107741867 ATAGGAAAAGGGGAGAGAAAAGG + Intronic
1196924369 X:120618840-120618862 GAATGCAAAGGTCTGAGAGAAGG + Intronic
1198138231 X:133776320-133776342 GTCTGCGAAGGGCTGAGACATGG - Intronic
1198384054 X:136111390-136111412 ATATGAAAAGTGCTTAGAATAGG - Intergenic
1198498925 X:137223251-137223273 ATATGTAAAATGCTTAGAAAAGG + Intergenic
1199784994 X:151097422-151097444 AAATGCAAAGGGTTGAGAATAGG + Intergenic
1201402194 Y:13615152-13615174 ACATACAAAGAGCTGATAAAAGG - Intergenic