ID: 957142091

View in Genome Browser
Species Human (GRCh38)
Location 3:76373427-76373449
Sequence TTATATGTGCATAATTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957142091 Original CRISPR TTATATGTGCATAATTTGGA TGG Intronic
902678566 1:18027020-18027042 ATATAAGTGCAGAATTAGGATGG - Intergenic
904102964 1:28049099-28049121 TTAAATATTCATAATTTGAATGG - Intronic
904303699 1:29573267-29573289 TCCTATGTATATAATTTGGATGG + Intergenic
905532375 1:38691798-38691820 TTAAATGGGCAAAATTTGAATGG + Intergenic
909240602 1:73207775-73207797 ATGTATGTGTATAATTTTGAGGG - Intergenic
909472850 1:76048855-76048877 TAATATGTTCATAATTTTGCTGG + Intergenic
911885580 1:103294450-103294472 ATATATTTGCATTATTTGTATGG + Intergenic
914993505 1:152518580-152518602 TTATTAGTGCATAATGTGTAAGG + Intronic
915124515 1:153654313-153654335 TTGTATGTGCAGTAGTTGGATGG + Intergenic
915866924 1:159511159-159511181 TGATATATGCAAAACTTGGATGG + Intergenic
915999711 1:160603501-160603523 ATATATTTGCATAGTTTTGAGGG + Intergenic
916772089 1:167919685-167919707 TTAACTGTGCATCATTTAGATGG - Intronic
916983437 1:170165183-170165205 TTATTTGGTCATAATTGGGATGG - Intronic
916984802 1:170179595-170179617 TTATGTGTGCAGATTCTGGAGGG + Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
918905084 1:190481345-190481367 TTATATGTGCATAAATGTGTGGG - Intergenic
921562595 1:216676380-216676402 TTTTATTGGTATAATTTGGAAGG + Intronic
1064487780 10:15813780-15813802 TTTTATTTGCATAATTTTTAAGG - Intronic
1064906670 10:20354404-20354426 TTATATTTGAATAACTTGAAAGG - Intergenic
1065900456 10:30202527-30202549 TAGTATTTGCATTATTTGGAGGG - Intergenic
1071687997 10:87782543-87782565 TTCTCTGTGAATTATTTGGAAGG + Intronic
1071854259 10:89607362-89607384 TTATATGGGCATAATGTGGTGGG + Intronic
1077735416 11:4785674-4785696 TTCTATTTGCAGAATTTGAAAGG - Intronic
1077820601 11:5735762-5735784 TTATTTGTCCATAATGTTGAAGG - Intronic
1078607367 11:12788792-12788814 CTATATGTGTATAATTTAAAAGG + Intronic
1080079807 11:28203156-28203178 TTAAATGTGCATTATTTCCATGG + Intronic
1080333726 11:31172959-31172981 TTATATGTGCATCATTTCTTTGG - Intronic
1080929713 11:36797006-36797028 GTGTATGTGTATATTTTGGAGGG + Intergenic
1081075504 11:38668038-38668060 TTATATGGGCACAAGGTGGAGGG + Intergenic
1081244074 11:40742605-40742627 TTATATGTGCATAATTACCCTGG + Intronic
1081326457 11:41751522-41751544 ATATATTTGCATAGTTTTGAGGG + Intergenic
1086310334 11:85529267-85529289 TTACATGTTCATAATTTGTCGGG - Intronic
1087583755 11:100092482-100092504 TGATTTGTGCTTAATATGGATGG - Intronic
1088128433 11:106457997-106458019 TGATATGTGCATAGTTTCCAAGG - Intergenic
1092373389 12:7935474-7935496 TTGTATATGCATTATTTGCAGGG - Intronic
1097607349 12:61771577-61771599 ATGTATTTGCATAATTTTGAGGG - Intronic
1099267722 12:80468258-80468280 TTATTTGCTCATAATTTTGAGGG + Intronic
1099525856 12:83718922-83718944 TTACATGTGCAGAATATGCAGGG - Intergenic
1100346348 12:93735125-93735147 ATTTATTTGCATATTTTGGAGGG - Intronic
1100452719 12:94722815-94722837 TGATATGTTCATCATTTTGAAGG + Intergenic
1105720124 13:23105052-23105074 TTACATTTGCAAAATTTGGGTGG - Intergenic
1107201384 13:37722896-37722918 GTATATGTGAAATATTTGGATGG + Intronic
1107860562 13:44656578-44656600 TTATAAGTGCTTAATTTAGCTGG + Intergenic
1109055815 13:57547106-57547128 GTTTATGTGCAGAGTTTGGAGGG - Intergenic
1109440920 13:62372074-62372096 TTAAATTTTCATAATTTTGAAGG + Intergenic
1109457900 13:62617403-62617425 TTAAATGTCCAAAATTTAGAAGG + Intergenic
1109589720 13:64462672-64462694 TTATATGTGTATAGGATGGAGGG - Intergenic
1109975867 13:69830796-69830818 ATCTATGTGCATGATTTTGAGGG - Intronic
1110893489 13:80719379-80719401 TTATTTGTTCATCATTTTGATGG - Intergenic
1111377032 13:87393776-87393798 TTATAAGAGCATAAATTTGAAGG + Intergenic
1111537545 13:89623476-89623498 TTATATGTGCTCAATATGCATGG - Intergenic
1112113195 13:96325135-96325157 TTTTATATGCATAATTGAGAGGG + Intronic
1112543246 13:100337875-100337897 TTATATGTGCATACTATGTCAGG - Intronic
1112802764 13:103131022-103131044 TTATACGTGAATAATTTACAGGG - Intergenic
1113093837 13:106642259-106642281 ATATATGCGCAAAATTTGGCAGG - Intergenic
1114969595 14:28009195-28009217 ATAAATGTGGATATTTTGGAGGG - Intergenic
1115530006 14:34318415-34318437 TTACTTGTGCAGAATTTGGATGG - Intronic
1115720373 14:36154371-36154393 TAATGTGTGCATAATTTTGGAGG - Intergenic
1116074592 14:40094370-40094392 TTATATTTGCATATTTTGGTAGG - Intergenic
1116375435 14:44193360-44193382 TTATATGTGCAAAATGTGGTTGG + Intergenic
1118587570 14:67369700-67369722 TAATATATGAATTATTTGGAAGG - Intronic
1118666733 14:68077988-68078010 TTATATGTACATAAGGTGGAAGG + Intronic
1119865985 14:77974899-77974921 TCAGTTGTGCATGATTTGGAAGG - Intergenic
1120031147 14:79642340-79642362 GTCTAAGTGTATAATTTGGATGG - Intronic
1123168750 14:106350863-106350885 TAATTTGTTCATTATTTGGATGG - Intergenic
1126244799 15:46491931-46491953 TTGTATTTGCATAGTTTTGAGGG - Intergenic
1127896075 15:63300014-63300036 TTATATGTGCATGAAATGGCAGG + Intronic
1128003417 15:64215724-64215746 GTATTTGTGTATAATTTGGTAGG + Intronic
1128115256 15:65101287-65101309 TGATACTTACATAATTTGGAAGG + Intronic
1130358514 15:83158164-83158186 TAATATGTGCCTAACTTGAAGGG - Intronic
1130875714 15:88012328-88012350 TTATTTGTGAATAATAAGGAAGG - Intronic
1131319302 15:91370697-91370719 TAATATGTTCAAAATTTGAAAGG - Intergenic
1131432427 15:92397211-92397233 TTACATGTGTATTATCTGGAGGG + Intronic
1131740575 15:95386349-95386371 TTAAATGTTCTGAATTTGGAGGG + Intergenic
1131928212 15:97409974-97409996 TTATAAGTGAGTAATTTGGGAGG - Intergenic
1136923247 16:34349023-34349045 TTTTATGTGCAACATTTTGAGGG - Intergenic
1136981326 16:35062783-35062805 TTTTATGTGCAACATTTTGAGGG + Intergenic
1138764812 16:59589550-59589572 GTATATGTGTATAATTTGAAGGG + Intergenic
1140583889 16:76264578-76264600 ATATATGTGTATAATTTGTTTGG + Intergenic
1141011922 16:80409500-80409522 TTCTCTGTGCATCATTTGGATGG - Intergenic
1141231089 16:82168435-82168457 TTATATGGGCAAGATTTGAATGG - Intronic
1203137880 16_KI270728v1_random:1740859-1740881 GTATATGTGCAGAATGTGCAGGG + Intergenic
1150282362 17:63936486-63936508 ATATATTTGTATAATTTTGAGGG + Intergenic
1153651453 18:7244346-7244368 ATATATGTGAAATATTTGGAAGG + Intergenic
1155239628 18:23853239-23853261 TGATATGAGCATAATATGAAGGG + Intronic
1155573597 18:27221459-27221481 ATATATTTGCATAGTTTTGAGGG + Intergenic
1155644983 18:28066266-28066288 TTATATGTAATTAATTTTGAAGG - Intronic
1155738330 18:29252618-29252640 TAATATGTTCATAAATTGGCGGG - Intergenic
1155818448 18:30345827-30345849 TTAAATGTGAAGAAATTGGAGGG - Intergenic
1156326903 18:36082305-36082327 TTGTATTTGCATAGTTTTGAGGG - Intergenic
1156942965 18:42793176-42793198 TTAAATGTGCATAATATGGGAGG + Intronic
1156974909 18:43208760-43208782 TTATATTTGAATAATTTAGGTGG - Intergenic
1158083062 18:53616761-53616783 TTATATCTGCTTAATTTAAAGGG - Intergenic
1159610262 18:70517088-70517110 TTACATGTGAATAATTTGGATGG + Intergenic
1163174922 19:15557533-15557555 TTATAAGTGTAAAATTTGAAAGG + Intergenic
1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG + Exonic
1164049743 19:21574820-21574842 TCATATGTACATACATTGGAAGG + Intergenic
1167853344 19:52218643-52218665 TTTAATGGGCATAATTTGGCAGG + Intronic
925767978 2:7255771-7255793 TTATATCTGGATTATTTGGAAGG + Intergenic
926473206 2:13287829-13287851 TGGTATGTGCATAAGTTTGAAGG - Intergenic
927024854 2:19056556-19056578 ATGTATGTGCATAGTTTTGAGGG + Intergenic
928568278 2:32575837-32575859 TTCTAAGTGTATAATTTGGGTGG - Intronic
928692513 2:33815418-33815440 AAATATGTGCATAATTTTAATGG - Intergenic
929775844 2:44930023-44930045 TTATCTGTGAATAATTGAGAAGG - Intergenic
929884471 2:45866214-45866236 TTACATGTGAATCATCTGGAAGG + Intronic
930560677 2:52956573-52956595 TTATAAGTGAATAAGATGGAAGG + Intergenic
931136773 2:59411802-59411824 CTGTATTTGCATAATTTTGAGGG + Intergenic
931569968 2:63657935-63657957 TTATATCTGCTTAATTTAAAAGG + Intronic
933112504 2:78421471-78421493 TTCTATGAGTATAATATGGAAGG + Intergenic
936968764 2:118153679-118153701 TTACAAGTGCATAATTTGCAAGG - Intergenic
937481384 2:122263592-122263614 TTATATGTGCACAACATGCAAGG - Intergenic
938710021 2:133968269-133968291 CTATCTCTGCATATTTTGGAAGG + Intergenic
939034753 2:137117487-137117509 TTAGATATTCATACTTTGGAGGG + Intronic
940061035 2:149568441-149568463 TTTTATTTTCATAATTTGGAGGG - Intergenic
940851188 2:158689631-158689653 TTATTTGAGCCTAATTTGGCTGG - Intergenic
941107212 2:161368604-161368626 ATATATGTGCTTTTTTTGGAAGG - Intronic
941193684 2:162419580-162419602 TTATTTGGGCATTATTTGGTGGG + Intronic
943228852 2:185218411-185218433 TTATTTTTGCTAAATTTGGATGG - Intergenic
943617886 2:190114788-190114810 TTATATTTTCAAAGTTTGGAAGG - Intronic
944031095 2:195235615-195235637 TTAGATGTGCACAATTTTCAAGG + Intergenic
944332411 2:198486508-198486530 TTATATATCTTTAATTTGGATGG + Intronic
944976344 2:205056047-205056069 CTAAATGTCCACAATTTGGAAGG - Intronic
945819261 2:214643528-214643550 TTATATGTGCTTATATTGGGGGG + Intergenic
945843480 2:214915658-214915680 TTAAATGAGCTTAATGTGGAAGG + Intergenic
947594036 2:231399782-231399804 TTATTTATGAAGAATTTGGAGGG + Exonic
1170488270 20:16842812-16842834 TTATGAGTGCATCATTTTGATGG + Intergenic
1173858204 20:46264786-46264808 ATACATGTTCATAATTTGCACGG - Intronic
1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG + Intronic
1176949761 21:15031015-15031037 TTCTATGTGTATACTCTGGAAGG + Intronic
1177566311 21:22827085-22827107 TAATATGTTTATAATTTGGGGGG - Intergenic
1180552700 22:16553416-16553438 GTATATGTGCAGAATGTGCAGGG + Intergenic
949314331 3:2734843-2734865 TTATATGTGATTATTTTGAAGGG - Intronic
949404708 3:3702034-3702056 AAAAATGGGCATAATTTGGAGGG - Intronic
951083528 3:18481902-18481924 TTTTAATTGCATAATTTGGTAGG + Intergenic
951428336 3:22576023-22576045 TCACATGTGCTTAATTTGGGTGG - Intergenic
951967392 3:28401771-28401793 ATGTATTTGCATAATTTTGAAGG - Intronic
952985289 3:38774043-38774065 ATATATGTTCATAATTTAAAAGG - Intronic
952988916 3:38813959-38813981 TAATATGTGCAAAGTTTTGATGG + Intergenic
954911245 3:54112368-54112390 GTATATGTGCATAATCATGATGG + Intergenic
955102846 3:55869012-55869034 TTATATGTTTATAATAAGGAAGG - Intronic
955909537 3:63845966-63845988 TTCTCTCTGCATAATTTGGGAGG - Intronic
956378337 3:68639549-68639571 TTTTGTCTGCATACTTTGGAGGG - Intergenic
957021739 3:75135982-75136004 TTATATCTGTATATTTTGAATGG - Intergenic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
957199196 3:77110573-77110595 TAATTTTTGCATAATTTGTAAGG - Intronic
957676301 3:83370694-83370716 TTATATGTATATATTTTGGGGGG - Intergenic
957797063 3:85023095-85023117 TTTTAAGTGCATTATATGGAAGG + Intronic
958498039 3:94870642-94870664 TTATATGTCCATAATATGATGGG - Intergenic
959100067 3:102000329-102000351 TTTCATGTGCATGATTTGGAAGG + Intergenic
959284050 3:104384282-104384304 TTATATATATATAACTTGGAGGG + Intergenic
959933625 3:112008217-112008239 TTATACTTGCACAATTTTGAAGG + Intronic
960097994 3:113706636-113706658 TTATATGGGCACAATTTGTGGGG + Intergenic
962870159 3:139481782-139481804 TTATAGGTACATAATTTTTATGG + Intergenic
964320897 3:155496061-155496083 TGATATGTGCCTAATTAGCAAGG - Intronic
964413092 3:156419669-156419691 TTATATTTGCATAACTTTGTAGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964707973 3:159640917-159640939 TTAAATTTGCATAATCTGGCAGG + Intronic
967334886 3:188333255-188333277 TTATATTTGGAGAATTTGGAAGG + Intronic
970040297 4:11789240-11789262 TTGTGTGTGCATAATATGTATGG + Intergenic
971769338 4:30876499-30876521 TTATACGTGATTCATTTGGAAGG + Intronic
973170563 4:47137859-47137881 TTATATATACATATATTGGATGG - Intronic
973911561 4:55586715-55586737 TGATATCTGTTTAATTTGGAAGG + Intronic
974351151 4:60748278-60748300 TTATATGTGAAAAGTTTGGCTGG + Intergenic
974666847 4:64972793-64972815 GTAAATGTGCATAAATTAGACGG + Intergenic
975654923 4:76632014-76632036 TTTTATCTGAATAATTGGGATGG + Intronic
976961217 4:90977444-90977466 TTATATGTGCTTGAATTGGTGGG + Intronic
977247568 4:94651179-94651201 TAATCTGTGCATAATTTCAAGGG + Intronic
979045785 4:115861410-115861432 TTATAGATGAATAAATTGGATGG - Intergenic
979071710 4:116216042-116216064 TTCTATGTGAATAATTGGCATGG - Intergenic
979140465 4:117166255-117166277 CTACATGTGCATATGTTGGAGGG + Intergenic
980621096 4:135305074-135305096 TCTTAGGTGAATAATTTGGAAGG + Intergenic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
982686795 4:158500371-158500393 GTACATGTGCATAATGTGCAGGG + Intronic
982992028 4:162288556-162288578 ATATATTTGCATGATTTTGAGGG - Intergenic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
984123370 4:175773661-175773683 TTATATGTTAACAATTTGAATGG + Intronic
985149644 4:186933501-186933523 TTATTGTTGCATAATTTGCAAGG - Intergenic
985813925 5:2112096-2112118 TTCTTTGTGGCTAATTTGGAGGG - Intergenic
985842131 5:2315086-2315108 TTATTTGTGTATAAATTGTAAGG + Intergenic
986099917 5:4598302-4598324 TTATATTTCAATAATTTGGGGGG - Intergenic
986941868 5:12962371-12962393 TTATATATGCAAAATGTGTAAGG + Intergenic
987015029 5:13809277-13809299 TTTTATGGGGAGAATTTGGAAGG - Intronic
988118537 5:26928368-26928390 TTTTATGTTCATAGTTTGGAAGG + Intronic
988175792 5:27723336-27723358 TTATATTTACATTATTTTGAAGG - Intergenic
988297608 5:29386311-29386333 TTATATATGTGTAATTTAGAAGG + Intergenic
989491751 5:42063749-42063771 TTATATGTACATTATTTGTATGG - Intergenic
989501073 5:42168678-42168700 TTACATGTGTATAATGTAGATGG + Intergenic
990608542 5:57434789-57434811 GTATATGGGCATCATTTAGAGGG - Intergenic
990798707 5:59574327-59574349 TTATATGTGCATAACTTATAGGG - Intronic
992180910 5:74197531-74197553 TGTTATGTGGACAATTTGGAAGG + Intergenic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
994828844 5:104750909-104750931 TTTTGTGTGCATAATTTAGTGGG + Intergenic
994968626 5:106706927-106706949 TTATAACTGCATTATTAGGATGG - Intergenic
996597507 5:125222539-125222561 TAATAGGTGCAGAATTTGGAAGG - Intergenic
997430366 5:133834491-133834513 TTATATGAGCCTAATTTTGTGGG + Intergenic
997717756 5:136054723-136054745 TTGTATGGGCATCAATTGGAGGG - Exonic
998078256 5:139253792-139253814 TTTTATGTGCTTATTTTTGAGGG - Intronic
998292678 5:140929692-140929714 TTATATGAATATAATATGGAAGG + Intronic
999605637 5:153312073-153312095 TTATAGGTAAATTATTTGGATGG + Intergenic
1001391245 5:171380988-171381010 TTTGATGTACATATTTTGGACGG + Intergenic
1009162243 6:60297487-60297509 ATATATTTGCATGATTTTGAAGG + Intergenic
1011223754 6:85084931-85084953 ATACATGTGCATAATGTGCAAGG - Intergenic
1011719953 6:90145043-90145065 TTATATGTGGTTTATTTGGGGGG - Intronic
1012114346 6:95276449-95276471 TGATATTTCCATAATTTTGAGGG + Intergenic
1012665838 6:101968146-101968168 TTATATTTGCATAAGATGCATGG - Intronic
1013657988 6:112265364-112265386 TTATATATCCATAATATGTAAGG + Intergenic
1015444972 6:133293194-133293216 TTATCTGGGCATACATTGGATGG - Intronic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1016270826 6:142288665-142288687 TTTTATTCTCATAATTTGGAGGG - Intergenic
1016812182 6:148272112-148272134 TTATATGTTAAGCATTTGGAAGG + Intergenic
1018538612 6:164851826-164851848 TAAAATGTGCACAATTTTGAGGG + Intergenic
1020473798 7:8570833-8570855 TTATATTTTGATAATTTGGTAGG + Intronic
1021403742 7:20239783-20239805 TGATATGTGTATATTTTGGGAGG + Intergenic
1021421039 7:20444794-20444816 TTTTATGGTTATAATTTGGAGGG - Intergenic
1021563598 7:21993726-21993748 TTCAATTTTCATAATTTGGAGGG - Intergenic
1023304413 7:38809186-38809208 TTAAATATGTATAATTTGGCTGG + Intronic
1024011708 7:45272335-45272357 ATACATGTGCATGATTTGAAAGG + Intergenic
1024428523 7:49259091-49259113 TTATTTGTGCATATATTTGAGGG - Intergenic
1025949376 7:66131623-66131645 TTATAATTACATATTTTGGAAGG - Intronic
1029327137 7:99819571-99819593 GTATGTGTGCATTATTTTGATGG + Intergenic
1031235700 7:119173555-119173577 TTATATTTGCATAATAAGAATGG - Intergenic
1031299378 7:120044348-120044370 TTATATGTGAGTAATTTTGAAGG - Intergenic
1034928615 7:155142973-155142995 TGAAATGTGCAGAATTTTGAGGG - Intergenic
1035919233 8:3658922-3658944 TTAAATATGCATTATTTGGTAGG - Intronic
1039081397 8:33737406-33737428 TCATAGGAGCATAATTGGGAGGG + Intergenic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1040529090 8:48251098-48251120 ATATATTTGCATAGTTTTGATGG + Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1041247668 8:55904567-55904589 TTATAGGTGCATGATCTGCAGGG - Intronic
1041554413 8:59136629-59136651 CTATATGTTTAAAATTTGGAGGG - Intergenic
1042074901 8:64982047-64982069 TTATATTTGGGTAAGTTGGAGGG - Intergenic
1043672088 8:82899258-82899280 ATGTATCTGCATAGTTTGGAAGG - Intergenic
1044235968 8:89830463-89830485 TTATTTATGCATTATTTGTATGG + Intergenic
1044978104 8:97686264-97686286 TTATATTAGCATGATGTGGAAGG + Intronic
1045486922 8:102638759-102638781 TTATATTTGCATAATTAAGAGGG - Intergenic
1046125513 8:109901669-109901691 TTATATGTACATTATTTAGTAGG + Intergenic
1046286580 8:112100730-112100752 GTATATCTACATATTTTGGAGGG + Intergenic
1046883265 8:119333741-119333763 TTATATTTGACAAATTTGGAAGG - Intergenic
1046980785 8:120334255-120334277 TTGTATGTGCATAACCTGTATGG - Intronic
1047011903 8:120681685-120681707 TGATATTTGCAGAATTGGGAAGG + Intronic
1050266883 9:3900487-3900509 ATATATGTGTATATTTTGGGGGG - Intronic
1050284321 9:4085558-4085580 TAATATGTCAATAATTTTGATGG - Intronic
1050444009 9:5698803-5698825 TTATATTTACATAATTCAGAAGG - Intronic
1051348981 9:16180739-16180761 TTATGTATGTATATTTTGGAGGG + Intergenic
1055351173 9:75389961-75389983 TTACATGTACATAATTTACATGG + Intergenic
1055380447 9:75700997-75701019 TAATATGTTTATAATTTTGATGG - Intergenic
1056134600 9:83619651-83619673 TTGAATCTGTATAATTTGGAGGG + Intergenic
1056668620 9:88603428-88603450 ATACATGTGCATAATGTGCAGGG - Intergenic
1060753853 9:126194598-126194620 TCATATGTCTATAATGTGGATGG + Intergenic
1185532880 X:835728-835750 GTATATGTGCAGAATGTGCAGGG + Intergenic
1186584179 X:10853948-10853970 TTCTATTTGCATGATGTGGAAGG - Intergenic
1187361538 X:18632276-18632298 TAAAAGGTGCATACTTTGGAAGG + Intronic
1187469503 X:19556183-19556205 TTCTATCTGCATGATTTGAAAGG - Intronic
1187537189 X:20152747-20152769 TTATATGTTCACAAAATGGAAGG - Exonic
1188233594 X:27698235-27698257 ATATATGTTATTAATTTGGAAGG + Intronic
1188291824 X:28398998-28399020 TTATAATTTCATAATGTGGATGG + Intergenic
1189569813 X:42284599-42284621 ATATATGTTCATGAGTTGGAAGG + Intergenic
1191768268 X:64726045-64726067 ATATCTGTGCATGATTTGGGTGG - Intergenic
1192051398 X:67727494-67727516 TCATTTGTGCATCATGTGGATGG - Exonic
1192101651 X:68271127-68271149 TTATATGTCAATTATTTGTAAGG - Intronic
1192348710 X:70336251-70336273 TTAAATGTGCATACATAGGAAGG - Intronic
1193335391 X:80282116-80282138 TAATATGTGCAAAATGTGAAAGG - Intergenic
1193666085 X:84319013-84319035 TCATATGTACACATTTTGGAAGG + Exonic
1193775739 X:85639522-85639544 TTGTATTTGCATAGTTTCGAGGG + Intergenic
1193829143 X:86266432-86266454 TTAGACTTGCATAATTTTGAAGG + Intronic
1194014499 X:88602776-88602798 ATGTATTTGCATAATTTTGAGGG + Intergenic
1194191780 X:90846045-90846067 ATATATTTTCATAATTTTGAGGG + Intergenic
1194499456 X:94661964-94661986 TTATCTGTGCATAACTTGTCAGG + Intergenic
1194749339 X:97667043-97667065 TCACATGTGCTTACTTTGGAAGG + Intergenic
1196785435 X:119417704-119417726 CTATATATGCATTATTTGGAAGG - Intronic
1197257890 X:124283710-124283732 TTAAATGGGCATAATTTCTAGGG - Intronic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1199065730 X:143415769-143415791 GTATATTTGTATAATTTTGAGGG + Intergenic
1199207938 X:145171128-145171150 CTATATGCGGATATTTTGGAAGG + Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1200538422 Y:4428479-4428501 ATATATTTTCATAATTTTGAGGG + Intergenic
1201231677 Y:11870915-11870937 TTATTTGAGGATAATTTGAAAGG - Intergenic