ID: 957142904

View in Genome Browser
Species Human (GRCh38)
Location 3:76384608-76384630
Sequence GACTCACAGTTCCACAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20276
Summary {0: 14, 1: 381, 2: 3819, 3: 7199, 4: 8863}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957142900_957142904 15 Left 957142900 3:76384570-76384592 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 957142904 3:76384608-76384630 GACTCACAGTTCCACAGGACTGG 0: 14
1: 381
2: 3819
3: 7199
4: 8863
957142899_957142904 16 Left 957142899 3:76384569-76384591 CCCAAGACTGGGTAATTTATAAA 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
Right 957142904 3:76384608-76384630 GACTCACAGTTCCACAGGACTGG 0: 14
1: 381
2: 3819
3: 7199
4: 8863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957142904 Original CRISPR GACTCACAGTTCCACAGGAC TGG Intronic
Too many off-targets to display for this crispr