ID: 957143583

View in Genome Browser
Species Human (GRCh38)
Location 3:76393611-76393633
Sequence CTGTAGATAATGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957143579_957143583 -6 Left 957143579 3:76393594-76393616 CCCTGTTTTGAGAAACACTGTAG 0: 1
1: 0
2: 4
3: 35
4: 302
Right 957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 322
957143580_957143583 -7 Left 957143580 3:76393595-76393617 CCTGTTTTGAGAAACACTGTAGA 0: 1
1: 0
2: 0
3: 31
4: 228
Right 957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG 0: 1
1: 0
2: 2
3: 34
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957143583 Original CRISPR CTGTAGATAATGAGGAAGGA AGG Intronic
900785840 1:4649933-4649955 CTCTATAATATGAGGAAGGAAGG + Intergenic
901566449 1:10119777-10119799 CTTTAGAAGATGAGGAAGAAAGG - Intronic
902045599 1:13521674-13521696 GAGGAGATCATGAGGAAGGAGGG - Intergenic
902556635 1:17250678-17250700 AAGGAGGTAATGAGGAAGGAGGG + Intronic
904727202 1:32558337-32558359 CTGTAGATAAGAAGGAGGGAGGG - Intronic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905851004 1:41274987-41275009 GGGGAGAAAATGAGGAAGGAGGG - Intergenic
905949023 1:41930041-41930063 TTGAAGATGATGAGGAAGAAGGG - Intronic
906661982 1:47589553-47589575 CTGGAGACGGTGAGGAAGGAGGG - Intergenic
907375219 1:54032192-54032214 CTGAAGATCATGAAGAAGCAGGG - Exonic
907681875 1:56571973-56571995 CTGTATTTGCTGAGGAAGGAAGG - Intronic
908618466 1:65949331-65949353 CTGTAGCAAATGATGGAGGAAGG - Intronic
910160283 1:84265024-84265046 GTGGAGATGAGGAGGAAGGATGG + Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
914385202 1:147162473-147162495 AAGTAGATGAGGAGGAAGGATGG + Exonic
914393098 1:147239594-147239616 CTGTAGATGATCAGGATGGAAGG - Intronic
915730225 1:158048198-158048220 CTGTAAATAAGAAGGATGGAAGG + Intronic
915920977 1:159974800-159974822 CTGAGGATCATGATGAAGGATGG + Intergenic
915977791 1:160401776-160401798 GTGTAGGTACTGAGGAAGGTGGG + Intronic
915985548 1:160460682-160460704 GGGAAGATCATGAGGAAGGAAGG + Intergenic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
919224915 1:194684623-194684645 CAGTAGAGAATGAGGAAAAAAGG - Intergenic
919984775 1:202665639-202665661 GTGTAGAAAATGAGGAAGTATGG - Intronic
920297608 1:204968547-204968569 TTTTGGATAATGAGGAAAGAAGG + Intronic
924917450 1:248586986-248587008 CTGTAGATCATTAAGAAGAAAGG - Intergenic
1063308769 10:4933081-4933103 AATTAGATAATGAGGAAGGATGG - Intronic
1063317985 10:5025014-5025036 AATTAGATAATGAGGAAGGATGG + Intronic
1063500493 10:6549309-6549331 ATGTAGATAGGGAGGAAGTACGG + Intronic
1063880048 10:10521977-10521999 CTGCAGCTAATGAGCAAGGATGG + Intergenic
1064886028 10:20113577-20113599 GTGTAGAAAATGAGTAAGGAGGG - Intronic
1068425603 10:56859652-56859674 TTGTATATAATGAGGAAAGGAGG + Intergenic
1068668582 10:59701423-59701445 CTGTGGGTAATGAGGAACCATGG - Intronic
1068811236 10:61257697-61257719 CTGTAGATTATGGGCAGGGATGG + Intergenic
1072717084 10:97759427-97759449 CTGGAGAGAGTGAGGAAGGAAGG - Exonic
1072765760 10:98093961-98093983 CTGGAGATAATAAAGAAAGAAGG + Intergenic
1072923096 10:99593243-99593265 CTGAAGATAAAGAGAAAGAAAGG + Intergenic
1072948765 10:99834561-99834583 TTATAGATAGAGAGGAAGGAAGG - Intronic
1072976204 10:100061048-100061070 ATGAAAATAAAGAGGAAGGATGG + Intronic
1073178801 10:101571533-101571555 CTTCAGATAAGGGGGAAGGAGGG + Intronic
1073232777 10:101986475-101986497 CTGTAGGTAATGATGGGGGAAGG - Intronic
1073323564 10:102629840-102629862 CTGTCAATAATGAGGCAGGTTGG - Intronic
1075833943 10:125436996-125437018 TTGTAGATGATGATGATGGATGG - Intergenic
1076590344 10:131578213-131578235 CTGCAGAACAAGAGGAAGGATGG - Intergenic
1078030182 11:7742324-7742346 CTGGAAATACTGAGGAATGAAGG + Intergenic
1079252041 11:18793517-18793539 ATGGAGAAAATGAGGAGGGAGGG - Intergenic
1080123471 11:28704044-28704066 CTGGAAAAAAGGAGGAAGGAAGG - Intergenic
1080156487 11:29117707-29117729 CTGTCAAAAATAAGGAAGGAAGG + Intergenic
1081557170 11:44175519-44175541 CTGCAGATGATGGGGAAGAAAGG - Intronic
1082063178 11:47877776-47877798 TTGTGGAGAAAGAGGAAGGAAGG - Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1083028560 11:59571310-59571332 CTGTAGTGAATTAGGAGGGAGGG - Intergenic
1084427541 11:69093911-69093933 CTGAAGACAGTGAGGATGGACGG + Intergenic
1084966969 11:72750097-72750119 CAGTAGGAAATGGGGAAGGAAGG - Intronic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085840278 11:80003656-80003678 TTGTAGATAAGCAGGAAGAAGGG + Intergenic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1089445216 11:118546483-118546505 CTGTAAAAAAAAAGGAAGGAAGG + Intronic
1090441635 11:126729559-126729581 CTGTAAACAATGAGGCTGGAAGG + Intronic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092630872 12:10375120-10375142 AAATAGATAATAAGGAAGGAAGG + Intronic
1092836372 12:12492910-12492932 AAGTAAATATTGAGGAAGGAAGG - Intronic
1092993541 12:13926499-13926521 CTGGAGAAACTGGGGAAGGAGGG - Intronic
1094768236 12:33622380-33622402 AAGTAGGTAATGAGGTAGGAGGG - Intergenic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096007420 12:48184138-48184160 CTGGAGATCATGACCAAGGACGG + Exonic
1096646352 12:53039069-53039091 CTGTAGAGGATGTGGAAAGAAGG + Intronic
1100313873 12:93425298-93425320 CTCTAGAGAATTAGGAAGTAAGG + Intronic
1100581051 12:95940903-95940925 CTGGAGGTCAAGAGGAAGGAAGG + Intronic
1101220779 12:102637580-102637602 CTATAGGTAGGGAGGAAGGAGGG - Intergenic
1102099745 12:110269340-110269362 GTGCAGATAAAAAGGAAGGAAGG - Intergenic
1103406645 12:120680581-120680603 CTGTAGACAATGAGGAATTTGGG - Intergenic
1104234125 12:126916089-126916111 CCCTAGATAAAGAGGAAGAATGG + Intergenic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1106312076 13:28563243-28563265 CTGTGGAGAATGTGTAAGGAAGG + Intergenic
1108107540 13:47027945-47027967 CTGGAGATAATCAGAAAGGATGG - Intergenic
1109138588 13:58683716-58683738 CTTTAAATGATAAGGAAGGAGGG - Intergenic
1109529842 13:63627668-63627690 TTTTACATAAAGAGGAAGGAAGG - Intergenic
1109587932 13:64434187-64434209 CTGAAGACAATGAGCAAAGAAGG + Intergenic
1109906414 13:68847284-68847306 CTATATATAATCAGGGAGGAGGG + Intergenic
1111714553 13:91863649-91863671 CTCTGGATAATGAGGATGCATGG - Intronic
1112741219 13:102474763-102474785 CTGTGGATATTGAAAAAGGAAGG - Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113271859 13:108683341-108683363 CTATAGAACAGGAGGAAGGAAGG - Intronic
1113833824 13:113315784-113315806 TTGAAGATACTCAGGAAGGAAGG - Intronic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1114678938 14:24467121-24467143 CTGTAGAGAAGTGGGAAGGATGG - Intergenic
1115629803 14:35232971-35232993 CTGTTGTAAAAGAGGAAGGAGGG - Intronic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1119894257 14:78206510-78206532 CTGTAAATAAAGAGGAACAAAGG + Intergenic
1120095693 14:80385339-80385361 GTGAAGAGAATGAGGAAAGAGGG - Intronic
1120681840 14:87489410-87489432 CTGTAGAAAAGGAGGAAGAAAGG + Intergenic
1122506968 14:102237878-102237900 CTGTAGATTATGAGGACTGTAGG - Intronic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1125931104 15:43600683-43600705 CTGTAGAACAGTAGGAAGGAAGG + Intronic
1126069231 15:44851253-44851275 CTGTTGACAATGAGGAAAGAAGG - Intergenic
1126089582 15:45039519-45039541 CCGTTGACAATGAGGAAAGAAGG + Intronic
1127003690 15:54541109-54541131 CTCTGGATAAAGAGGAAGGTTGG - Intronic
1127101420 15:55569111-55569133 CTTTATAGAATGAGTAAGGAAGG + Intronic
1128526281 15:68414544-68414566 TTCTAGAAAATGAGGAAGTAGGG + Intronic
1129142359 15:73611581-73611603 CAGGAGATAAGAAGGAAGGAGGG + Intronic
1129632507 15:77276634-77276656 TCGTGGATAATGAGGAAGGCAGG + Intronic
1129957655 15:79654243-79654265 CTTTAGCTCATGAGGAAGGTAGG - Intergenic
1130667287 15:85880342-85880364 GTGAAGGAAATGAGGAAGGAAGG + Intergenic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1133723276 16:8514823-8514845 CTCTAGATAATGAAAAAGGAAGG - Intergenic
1134822558 16:17258418-17258440 AGGAAGAAAATGAGGAAGGAAGG + Intronic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1137238648 16:46636276-46636298 CTGTTGATAATGGGGGAGGCTGG + Intergenic
1137714688 16:50591582-50591604 CTGTACAAAAAGAGGAAGCATGG - Intronic
1139201964 16:64986955-64986977 CAGTAGCTAAAGAGGAGGGAAGG - Intronic
1139259563 16:65578801-65578823 CTTTAGAAAATGAGGCAGGGGGG - Intergenic
1140651572 16:77094134-77094156 GTGTACATGAAGAGGAAGGAAGG - Intergenic
1141481042 16:84307097-84307119 CTGGAGAGAATGAGTAAGGAGGG + Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141790067 16:86228253-86228275 CTGTGGCTTATGAGGAGGGAAGG + Intergenic
1142220042 16:88849813-88849835 CTGAAGCTGATGAGGAAGAAAGG + Intronic
1143249427 17:5511811-5511833 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1146027479 17:29333982-29334004 CCGAAGATAATGAGTGAGGAGGG + Intergenic
1146558674 17:33849400-33849422 CTGTGGAGACTGAGGAATGAGGG + Intronic
1147041227 17:37720891-37720913 TTGTAGACAATGAAGAAGAACGG + Intronic
1148023165 17:44566999-44567021 ATGTTGATAATGGGGAAGGTAGG - Intergenic
1148947982 17:51282462-51282484 ATGAAGAGAAAGAGGAAGGAAGG + Intronic
1148962087 17:51401802-51401824 CTGTAGATAATGACAAAGCAAGG - Intergenic
1150203911 17:63385990-63386012 CTTGATAAAATGAGGAAGGATGG - Intronic
1151733058 17:75922242-75922264 CTGTGGACATTGAGGCAGGAAGG - Intronic
1153584483 18:6607335-6607357 CTGTAGACAATGAGAAATGCCGG + Intergenic
1153691673 18:7600683-7600705 CTGCAGCTAGTGAGGAAGCAGGG - Intronic
1154339698 18:13492763-13492785 ATGGAGAAAATGAGGAAGGGGGG - Intronic
1155126577 18:22883266-22883288 CTCTAGAGAATGAGGAGGGTCGG - Intronic
1156214721 18:34984701-34984723 ATGTAGATTATGATAAAGGAGGG - Intronic
1157312894 18:46565551-46565573 CTGCAGATACTGAGGAATGACGG - Intronic
1157691319 18:49684417-49684439 CTTCAGATAATGAGTAAGAAGGG + Intergenic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1159578482 18:70207603-70207625 CTGTAGTTATCCAGGAAGGAAGG + Intergenic
1159831217 18:73280308-73280330 ATGTAGACAAGGACGAAGGAAGG + Intergenic
1160606675 18:80056739-80056761 CTTTGGATACTGAGGCAGGAAGG - Intronic
1162316938 19:9945158-9945180 CAGCAGAAAAAGAGGAAGGAAGG + Intergenic
1163621967 19:18366416-18366438 TTGTGCATTATGAGGAAGGATGG - Exonic
1164196284 19:22965573-22965595 CTAAAGAGAAGGAGGAAGGAAGG - Intergenic
1164811115 19:31156827-31156849 CTGTAGGTCATGATTAAGGAAGG - Intergenic
1165844728 19:38810841-38810863 ATGAAGAAAATGAGGAGGGAAGG - Intronic
1166563680 19:43750221-43750243 CTGCAATTGATGAGGAAGGAGGG - Intronic
925940485 2:8812520-8812542 AGGTAGATAAGTAGGAAGGAAGG + Intronic
926552953 2:14322024-14322046 TGGTAGGTAATAAGGAAGGAGGG - Intergenic
926786609 2:16524125-16524147 GTGGAGATAATGAGGAAGGTGGG - Intergenic
927234383 2:20856905-20856927 CTTTACTTAATGAGGAAAGAGGG - Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
928187029 2:29119870-29119892 CTATAGATTATGAGGCAGAATGG - Intronic
929093849 2:38245597-38245619 CTGTACATCCTCAGGAAGGAAGG + Intergenic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
932024151 2:68116674-68116696 CTGGAGACCATGAGGAGGGACGG - Intergenic
935939958 2:108228000-108228022 CAATATATTATGAGGAAGGAAGG + Intergenic
937382711 2:121395049-121395071 CCGTTGACAATGAGGAAGGAAGG + Intronic
937708706 2:124952299-124952321 TTGAAGATAATGAGGTAAGAAGG + Intergenic
938557106 2:132435292-132435314 CTGAGGAGAACGAGGAAGGAGGG - Intronic
938759078 2:134407391-134407413 GTGTAGATAAGGGGGAGGGAAGG - Intronic
939282361 2:140080589-140080611 CTGTAGATGATGAGTGAGAATGG + Intergenic
939649645 2:144745318-144745340 CTTTAAATGATGTGGAAGGAGGG + Intergenic
940200158 2:151141485-151141507 TTGTAGATGATTAGGAGGGAGGG - Intergenic
941269423 2:163407310-163407332 TTGTAGACAATGATGAAGGTAGG + Intergenic
942214747 2:173707681-173707703 GTGTGGATAATGAGGGAGAATGG + Intergenic
943529388 2:189060064-189060086 ATGATGATAATGATGAAGGAGGG - Intronic
944050174 2:195459203-195459225 CTCTAGATAGTCATGAAGGAAGG + Intergenic
944819326 2:203414003-203414025 CTGAAGAGGATGAGGCAGGAAGG - Intronic
944914775 2:204347251-204347273 GAGTAGATAATGAAGAAGGAAGG + Intergenic
944962777 2:204894490-204894512 CTGTTAATAATGAGGAAGCTGGG - Intronic
945151042 2:206792289-206792311 CTGTTGAAAATGAGTGAGGATGG + Exonic
946783010 2:223211605-223211627 CTGGAGATAATGTGGAGGAAAGG + Intergenic
946827755 2:223696115-223696137 GAGTGGATAATGAGGAAGGTGGG - Intergenic
946833308 2:223746934-223746956 CTGTTCTAAATGAGGAAGGAAGG + Intergenic
947414066 2:229875184-229875206 CTGTGGATAGTGATGAAGGATGG + Intronic
949048932 2:241886736-241886758 CTGCAGAGAATGAGGAAAAATGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168890948 20:1295111-1295133 CTGCTGTTAATGTGGAAGGAGGG + Intronic
1169499702 20:6147717-6147739 CTGGGGATAATGAATAAGGAAGG + Intergenic
1169553725 20:6727607-6727629 CTGTGGCTGATGAGGAATGAGGG + Intergenic
1169689580 20:8315591-8315613 ATGTATAAAATGAGGGAGGAAGG + Intronic
1170118072 20:12882855-12882877 TTGTAGAGACTGAGCAAGGAGGG + Intergenic
1170155438 20:13264876-13264898 CTGATGAGAATGAGGAAGGAGGG + Intronic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170743605 20:19079096-19079118 CAGTAGAGAATTAGGAAGGTGGG + Intergenic
1171384523 20:24761160-24761182 ATGTTGATAATGGGGAAGGTTGG + Intergenic
1175101216 20:56580112-56580134 CTGTAGAAATGGAGGAGGGAAGG + Intergenic
1175602503 20:60286508-60286530 CTGCAGATAATGATGCAGCAAGG + Intergenic
1177623309 21:23625453-23625475 CTGCACATAATGTGGAATGATGG + Intergenic
1177651948 21:23968881-23968903 CTGTAGCTGCTGAGGAAGGGAGG + Intergenic
1177917502 21:27108181-27108203 CTGTTGATCATGGGAAAGGATGG + Intergenic
1182480484 22:30605683-30605705 CTGGAGGTTCTGAGGAAGGAGGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182734288 22:32520243-32520265 CTCTAGAGACTGAGGCAGGAGGG - Intronic
1182958702 22:34452038-34452060 TTGTATATAATAAGGAAGAAGGG + Intergenic
1184121220 22:42451753-42451775 CTGTACAGAATGGGGAATGAAGG - Intergenic
949138451 3:601235-601257 TTTTAGATATTGATGAAGGATGG + Intergenic
949811340 3:8009855-8009877 CCATAAATAATGAGGATGGATGG - Intergenic
951778051 3:26332136-26332158 CTGGAGATACTGAGAGAGGAGGG + Intergenic
951785687 3:26416273-26416295 TTTTAGATAATGAAGAATGATGG + Intergenic
953721757 3:45362241-45362263 CTGGAGATAAAGAGGAGGGCAGG - Intergenic
954918096 3:54165497-54165519 CTCCATATATTGAGGAAGGAAGG + Intronic
955724767 3:61921155-61921177 CTGTAGATAGGTAAGAAGGAAGG - Intronic
955817424 3:62860388-62860410 CTGCAGATACTGAGGGATGATGG - Intronic
957143583 3:76393611-76393633 CTGTAGATAATGAGGAAGGAAGG + Intronic
957866586 3:86032864-86032886 CTGTAGAGAATGAGAAAGGCAGG - Intronic
957982471 3:87526853-87526875 CAGTAGGTAAAGAGGAAGAAAGG - Intergenic
960087123 3:113603403-113603425 CTGTAGGCAATAAAGAAGGAAGG + Intronic
960584035 3:119304280-119304302 CTGTAGAGGATGAGCAAGCAGGG + Intronic
960791022 3:121430974-121430996 CTGCAGAGAATGAGGCAGAAGGG + Intergenic
960885345 3:122388215-122388237 TTGGAGATACTGAGTAAGGAAGG + Intronic
961084213 3:124052650-124052672 CTCTAGAAAATGTGGAAGAAAGG - Intergenic
964461220 3:156931675-156931697 CTGCAGATAATGTGGTAGCATGG + Intronic
965601860 3:170462464-170462486 CTATAGATTCTGAAGAAGGATGG + Exonic
966365353 3:179180174-179180196 CTGTAGATAATGAAGTGGGTGGG + Intronic
966709209 3:182952744-182952766 TTGTGTATGATGAGGAAGGAAGG - Intronic
967243417 3:187463750-187463772 CTTGAGGCAATGAGGAAGGAAGG - Intergenic
968330501 3:197865108-197865130 CTGTAGAGGCTGAGGAGGGAGGG - Intronic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
970297135 4:14642126-14642148 CTGGAGATAGGAAGGAAGGAAGG + Intergenic
971303382 4:25460480-25460502 ATGTAGAAAATGAAAAAGGAGGG - Intergenic
971421241 4:26475919-26475941 TTGTACATAATGAGGGATGACGG - Intergenic
972005967 4:34106286-34106308 CTGTAGATAATGAGTAGACAGGG + Intergenic
972721964 4:41708807-41708829 CAGGAGCTAAGGAGGAAGGATGG - Intergenic
973025386 4:45262627-45262649 CTGTAAATATTGAGTTAGGAAGG + Intergenic
973547342 4:51995201-51995223 CTGGAGATAGTAAGGAAAGAGGG - Exonic
975409552 4:74033288-74033310 GTGTAGAAAATGAGGAATGGTGG + Intergenic
975512775 4:75211706-75211728 ATGTAGAAATTGAGGAGGGAAGG - Intergenic
976369186 4:84267399-84267421 CTGTAGGCAATGAGAAAGCATGG + Intergenic
979626755 4:122853530-122853552 CTTTTGAGAATTAGGAAGGAGGG + Intronic
980969788 4:139557174-139557196 GTGGAGCTAACGAGGAAGGAAGG + Intronic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981077772 4:140607946-140607968 CTGCAGTTAGTGAGGAGGGAGGG + Intergenic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
985299677 4:188474871-188474893 CTGAAGATAATCAGAAAAGATGG + Intergenic
986318849 5:6611069-6611091 CTGCAGGTAATGACGAAAGATGG - Exonic
986472649 5:8091362-8091384 GTGTTGAAAATGAGGAAGGAGGG + Intergenic
986674272 5:10169352-10169374 ATGTGGAAAATGAGGAAAGAGGG - Intergenic
986749811 5:10776821-10776843 CTGGTGGGAATGAGGAAGGAGGG - Intergenic
988290415 5:29277060-29277082 AGGTAGATAATCAGCAAGGAAGG + Intergenic
988832059 5:34997576-34997598 CTGTAGAGATTGAGCCAGGAAGG - Intergenic
990823269 5:59867649-59867671 CTGTAGGTAGTGACAAAGGATGG + Intronic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
993843621 5:92911481-92911503 ATGTAGATAAGCAGGAAAGAAGG - Intergenic
994490167 5:100431724-100431746 GTATAGATAATTGGGAAGGAAGG + Intergenic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
995305232 5:110639119-110639141 CTGAACATAATGAGTAAGTAGGG + Intronic
995378677 5:111507993-111508015 CTGTAGACAATGAGGTATGATGG - Intronic
995449609 5:112286235-112286257 CTGTAGATATTATGGAAGCAAGG - Intronic
995736173 5:115302182-115302204 CTGTGGAAAATGAGCAAGCAGGG - Intergenic
996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG + Intergenic
996682610 5:126244267-126244289 CTGTTGAAAATGAGAAAAGATGG - Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
998035337 5:138910555-138910577 CCTTAGAAAAGGAGGAAGGAAGG - Intronic
999019051 5:148143017-148143039 TTGTAGTCAATCAGGAAGGAAGG - Intergenic
999855984 5:155594659-155594681 CTGTACATAGTCAGAAAGGAGGG + Intergenic
1000188626 5:158886117-158886139 TTGTAGATAATCTGGAAGGTAGG - Intronic
1000440789 5:161260689-161260711 CTGTAAATAATGAGCAAGTTTGG + Intergenic
1004406538 6:15338476-15338498 CTGTAGACATTGAGGACAGATGG + Intronic
1004751495 6:18566261-18566283 GAGTAGGGAATGAGGAAGGAAGG - Intergenic
1004859518 6:19787868-19787890 AAGGAGAGAATGAGGAAGGAAGG - Intergenic
1004954840 6:20717884-20717906 CAGTAGAGAAGGAGAAAGGATGG + Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1009440934 6:63677284-63677306 GTGTAGATAAAGAAGAAAGATGG + Intronic
1009641541 6:66343427-66343449 CTGCAGATAAGGAAGAAGTAAGG + Intergenic
1010050228 6:71495405-71495427 CTGCAAAGAATGGGGAAGGAAGG + Intergenic
1010497250 6:76549865-76549887 ATTGAGATAATGAGGAATGAGGG - Intergenic
1011100932 6:83721440-83721462 CTGTAGTTAATGCTGAAAGATGG - Intergenic
1015055961 6:128903818-128903840 CTGTGGAGGATGGGGAAGGACGG + Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1017334199 6:153236187-153236209 GTGGAGAGAATGAGGAAGAAAGG - Intergenic
1017770426 6:157639940-157639962 CTGCATGTAATGTGGAAGGAGGG + Intronic
1017776317 6:157683782-157683804 CTGGAGATAATGAGAACAGATGG + Intergenic
1017813194 6:157999085-157999107 CTATAGATCATGAAGAAGGAAGG + Intronic
1018291620 6:162297807-162297829 CTGTAATTAATGAAGCAGGAAGG - Intronic
1018698027 6:166405782-166405804 TTGTAGGTAATGAGGTAGAAAGG + Intergenic
1018816811 6:167339002-167339024 GAGTAGAAAAGGAGGAAGGAGGG - Intronic
1019684301 7:2372260-2372282 ATGGAGAAAAGGAGGAAGGAAGG + Intronic
1020317571 7:6917342-6917364 CTGCAGGTAATGAGGATTGATGG - Intergenic
1021288616 7:18815677-18815699 CTGTAAAGAATCTGGAAGGAGGG - Intronic
1022315158 7:29238877-29238899 CTGGAGAAAATGAGCAAGGCGGG + Intronic
1023369252 7:39496653-39496675 CTGTACAGAGTGAGGAAAGAAGG - Intergenic
1023708199 7:42964465-42964487 CTGTAGATAATGAGGTAACAGGG + Intergenic
1024465298 7:49705911-49705933 CTGTAGAAAAGGAGGAGGGCAGG - Intergenic
1024539528 7:50464731-50464753 CTGGCCATAATGAGGATGGAGGG + Intronic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1026366054 7:69649597-69649619 CTGTAGATACATAGGAATGAGGG - Intronic
1026478715 7:70760647-70760669 CTGGATCCAATGAGGAAGGAAGG - Intronic
1028074504 7:86494905-86494927 CTGCAGGTGATGAGGAAGAATGG - Intergenic
1028305065 7:89252869-89252891 CTGGAAATACTGGGGAAGGAGGG + Intronic
1028698311 7:93744214-93744236 GTGAAGATCAGGAGGAAGGAAGG + Intronic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1030717774 7:112830550-112830572 ATGTATATCTTGAGGAAGGAAGG + Intronic
1030946086 7:115722481-115722503 TTGTAGATAAACAGGAAAGAGGG + Intergenic
1031539801 7:122980508-122980530 CTGTAGTTAATGGTGAAGTAAGG - Intergenic
1032883876 7:136116875-136116897 CTGTGGCTGAAGAGGAAGGAGGG - Intergenic
1033256572 7:139806705-139806727 CTGGAGATAATGAAGCAGAATGG - Intronic
1033411322 7:141120220-141120242 CTGCAGATAAAAAGAAAGGAAGG - Intronic
1033847517 7:145452521-145452543 GTGGAGATAATGAGGAGTGATGG - Intergenic
1034024880 7:147690049-147690071 CTGTAGACAATGAGGAAGAAAGG - Intronic
1034844261 7:154429964-154429986 CTTTAGAATATCAGGAAGGATGG - Intronic
1035110102 7:156474669-156474691 CTTTAGGTAATGAGAGAGGAAGG - Intergenic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037380372 8:18278582-18278604 CTGGAGATCTTGAAGAAGGAGGG - Intergenic
1037586569 8:20280773-20280795 CTGGATCTAAGGAGGAAGGATGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038279243 8:26148770-26148792 CAGTCGAGAATAAGGAAGGATGG - Intergenic
1038431591 8:27504691-27504713 CTGTTGTCAAGGAGGAAGGAGGG + Intronic
1038546095 8:28426748-28426770 CTGTTGAAAGTGAGGAAGGCTGG + Intronic
1038740952 8:30216140-30216162 CTGTAGAGACAGAGGAGGGAGGG - Intergenic
1040636361 8:49278360-49278382 CCATAGATAATGATGAAAGAAGG + Intergenic
1040752715 8:50729709-50729731 CTGTATGTAAAGAGGAAGGGAGG + Intronic
1040999756 8:53438940-53438962 TTGTGGAGAATGAGAAAGGAAGG - Intergenic
1041501743 8:58546505-58546527 CTGGAGAAAATGGGGAAGGGAGG - Intergenic
1041863101 8:62536501-62536523 CTGTAGAAACTGAATAAGGAAGG + Intronic
1041935140 8:63324931-63324953 CTGAAGCTAAATAGGAAGGATGG - Intergenic
1045449712 8:102310254-102310276 CTTTTGGAAATGAGGAAGGAGGG - Intronic
1047079226 8:121442041-121442063 ATGAAGAAAATGAGGAAGAAAGG + Intergenic
1047495215 8:125404253-125404275 TTGTTGATAAGAAGGAAGGAAGG - Intergenic
1048192724 8:132304944-132304966 CTGAAGGAAAGGAGGAAGGAAGG + Intronic
1048438994 8:134445903-134445925 CTGTGGCTAATGATGAGGGAAGG + Intergenic
1048761937 8:137804902-137804924 CTGAAGGAAAGGAGGAAGGAAGG + Intergenic
1049012898 8:139899455-139899477 GTGAAGATAAGGATGAAGGATGG - Intronic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1049621565 8:143600593-143600615 CTGTGGCTGATGAGGAAGCAGGG - Exonic
1050025938 9:1334691-1334713 CTGTATATTATGAGGAAGGAAGG - Intergenic
1050827013 9:9959586-9959608 CTGAAGAGAATGAGGTAGAAAGG + Intronic
1051604887 9:18909186-18909208 TTGCAGAAAATGAGGAAGGGAGG + Exonic
1051720695 9:20034156-20034178 GTGTAGATAATCAAGCAGGAAGG - Intergenic
1052409407 9:28103881-28103903 CTGGAAACAATGAGGAAGTAGGG + Intronic
1054846547 9:69804683-69804705 ATGTAGAAAATAGGGAAGGAAGG - Intergenic
1055926294 9:81513674-81513696 GTGTATAAAATAAGGAAGGAAGG + Intergenic
1056294594 9:85179780-85179802 CAAGAGATTATGAGGAAGGATGG - Intergenic
1057626917 9:96686244-96686266 CTGTGGAAAATCACGAAGGAAGG + Intergenic
1058613578 9:106801527-106801549 CAGTAGAAAATGAAGAAGAAAGG + Intergenic
1059195114 9:112363997-112364019 CGGTAGTTAGTGAGGAGGGAGGG - Intergenic
1060395936 9:123316583-123316605 GTGCAGAGAAAGAGGAAGGAAGG + Intergenic
1185593066 X:1291427-1291449 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1186065021 X:5754041-5754063 GAGGAAATAATGAGGAAGGAAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187452671 X:19412585-19412607 CTGAAGAGAAAGAGGAAGGGAGG + Intronic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1187700627 X:21961565-21961587 TGGTAGAAAATGAGGCAGGAGGG + Intronic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1188321073 X:28737956-28737978 ATGTAGAAAAGAAGGAAGGAAGG + Intronic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1189431089 X:40948066-40948088 CTGTTGAGAATGAGGAACAACGG + Intergenic
1191131839 X:57022253-57022275 CTGTAGGCAAGGAGGAGGGAAGG - Intergenic
1194268796 X:91784036-91784058 CTGTACAGAATAAGTAAGGAAGG + Intronic
1194536258 X:95108532-95108554 CTGATGATGAGGAGGAAGGAGGG - Intergenic
1195100690 X:101551724-101551746 GTGTAGATAAGAGGGAAGGAGGG - Intronic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1196040663 X:111199854-111199876 CTGTTGATCATGAGGAGGAAAGG + Intronic
1196361356 X:114864419-114864441 ATGTAAATTGTGAGGAAGGAAGG - Intronic
1197469039 X:126844349-126844371 ATGTATATAATGTGGAATGATGG - Intergenic
1197771064 X:130089710-130089732 CAGGAGACAATGAGCAAGGAAGG - Intronic
1198375825 X:136039064-136039086 TTTTAGAAAATGAGGAGGGAGGG + Intronic
1198446927 X:136726638-136726660 CAGTAGAAAATGTGGGAGGAAGG - Intronic