ID: 957144437

View in Genome Browser
Species Human (GRCh38)
Location 3:76405209-76405231
Sequence AACCTTAAGAAGCTTCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957144437_957144442 29 Left 957144437 3:76405209-76405231 CCAGCCAGAAGCTTCTTAAGGTT 0: 1
1: 0
2: 0
3: 13
4: 161
Right 957144442 3:76405261-76405283 AGAACAAGGTTGCTTGTTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 171
957144437_957144440 -4 Left 957144437 3:76405209-76405231 CCAGCCAGAAGCTTCTTAAGGTT 0: 1
1: 0
2: 0
3: 13
4: 161
Right 957144440 3:76405228-76405250 GGTTCTCATATAAGGTTAAAAGG 0: 1
1: 0
2: 0
3: 12
4: 165
957144437_957144441 15 Left 957144437 3:76405209-76405231 CCAGCCAGAAGCTTCTTAAGGTT 0: 1
1: 0
2: 0
3: 13
4: 161
Right 957144441 3:76405247-76405269 AAGGCTCTTATATGAGAACAAGG 0: 1
1: 0
2: 1
3: 9
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957144437 Original CRISPR AACCTTAAGAAGCTTCTGGC TGG (reversed) Intronic
900209837 1:1449742-1449764 TACCATAAAAATCTTCTGGCCGG - Exonic
900512410 1:3066918-3066940 AACCTGCAGAGGCTTCAGGCAGG + Intergenic
902643205 1:17779908-17779930 AAGCTTAAGAACCTTTTGGCTGG + Intronic
903143291 1:21353301-21353323 AAAAATAAGAATCTTCTGGCTGG - Intergenic
903307957 1:22427265-22427287 ACCCTTAAGGAGCTTCAGTCTGG + Intergenic
905061761 1:35145796-35145818 AACCTTAAGAAGGGTTTTGCAGG - Intergenic
905933001 1:41802958-41802980 AACCCTAGGAAGCAGCTGGCAGG + Intronic
905966785 1:42104995-42105017 AACCTTAGGATGCTGCTGGAGGG - Intergenic
907898078 1:58711490-58711512 GCCCTTAAGAAGCTCATGGCTGG - Intergenic
908006154 1:59731509-59731531 AACCTTAAGAAGGTTGTAGGGGG + Intronic
910943217 1:92559475-92559497 CACATTAAGAGGATTCTGGCTGG + Intronic
914725540 1:150324073-150324095 ATCTTTAAGAATGTTCTGGCCGG - Intronic
915935969 1:160090569-160090591 CACCTTAAGAGGCATCTGGCAGG - Intergenic
916105508 1:161427395-161427417 AAACTTAAATAGTTTCTGGCCGG - Intergenic
916284527 1:163091234-163091256 AACGTAAAGAAGCCTCAGGCAGG - Intergenic
918439820 1:184555795-184555817 TAGCTAAACAAGCTTCTGGCAGG + Intronic
919765888 1:201127185-201127207 CACCTTCAGCAGCCTCTGGCCGG + Intergenic
920280811 1:204842311-204842333 AAGCTTAAGAAAGTTCTGGGTGG - Intronic
920418726 1:205815459-205815481 AACACTAAGACGCTGCTGGCAGG - Intergenic
920814751 1:209320739-209320761 AAGATTAATAAGCTCCTGGCAGG - Intergenic
922223371 1:223625835-223625857 ACTCTTAACCAGCTTCTGGCTGG + Exonic
922384485 1:225068824-225068846 CAGCTTAAGAAGCTTTTGGGAGG + Intronic
924795276 1:247288298-247288320 AACCTTATGAAGCTTGTGCCAGG - Intergenic
1063856986 10:10266039-10266061 AACCAAAGGAAGCTTCTGGGGGG + Intergenic
1066132949 10:32412311-32412333 AGCATTAAGAAACTTCTGGGTGG - Intergenic
1068180364 10:53510944-53510966 CACCTTAAGAAACTACAGGCCGG + Intergenic
1070051715 10:72895793-72895815 ACCATTGAGGAGCTTCTGGCAGG + Intronic
1072285236 10:93908233-93908255 AAGATTAAGAAGCTCTTGGCTGG - Intronic
1072309047 10:94136894-94136916 TACATTAAGATCCTTCTGGCCGG + Intronic
1072738191 10:97893509-97893531 AGTCTAAAGAGGCTTCTGGCAGG - Intronic
1076339059 10:129730091-129730113 AACATCTAGAAGCTTCTTGCTGG - Intronic
1079541431 11:21580503-21580525 AAGCATAAGGAGCTGCTGGCAGG + Intergenic
1080650989 11:34222672-34222694 AGCCTTAAGAGGCTTCTGGGAGG - Intronic
1082788211 11:57329170-57329192 AACCTTCATAAGCATGTGGCAGG + Intronic
1085946093 11:81275640-81275662 ACCATTAAGATGCTTCTGGATGG - Intergenic
1087861189 11:103159006-103159028 CACCTGAAGAAGCTTTTTGCTGG + Exonic
1090619027 11:128544950-128544972 AACCCTAAGAAGTTTCTGAAAGG - Intronic
1090741464 11:129665298-129665320 AATATTAATAAGCTTCTTGCTGG - Intergenic
1090979046 11:131700965-131700987 AACTTTAAGAAACTTCTGTAAGG - Intronic
1092745110 12:11665908-11665930 AAGCTTGAGAACCTTCAGGCTGG + Intronic
1092878276 12:12867442-12867464 AATTTTAAGAATATTCTGGCCGG - Intergenic
1093006832 12:14060365-14060387 CACCTTAAGTAGCTGCTGGGAGG + Intergenic
1093317078 12:17665797-17665819 GACATTAAGAGGTTTCTGGCTGG - Intergenic
1094607025 12:31957931-31957953 ATCTTTAAGAATATTCTGGCCGG + Intergenic
1097665125 12:62469237-62469259 ATCCTCCAGCAGCTTCTGGCTGG - Intronic
1097791820 12:63823210-63823232 AACCTGAAGGAGGTGCTGGCTGG - Intergenic
1100521116 12:95376923-95376945 AAGGTTAGGAATCTTCTGGCCGG - Intergenic
1100990746 12:100248923-100248945 AAACTTAAGAAGCTTCTACATGG - Intronic
1101901423 12:108793882-108793904 GACCTTGAGTAGCTGCTGGCTGG - Intronic
1103894427 12:124263722-124263744 AACGGCAAGAAGCTTCTGGAAGG - Intronic
1110163667 13:72410470-72410492 AACCTAAAGAAGCATTTGCCAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1113912293 13:113848599-113848621 ATCCTGAAGAAGTTTCCGGCCGG - Intronic
1113998558 14:16119644-16119666 TACCTCAAAAAGCTTCTGTCTGG - Intergenic
1115103073 14:29726549-29726571 GACCTTAAGAAGCTACTGTCGGG + Intronic
1115756155 14:36527527-36527549 AACCTTAATAACCTTCTGCTAGG + Intergenic
1116346023 14:43795335-43795357 AGAATTATGAAGCTTCTGGCAGG - Intergenic
1116499634 14:45605052-45605074 AACTTTAAGAATATTGTGGCCGG - Intergenic
1116692415 14:48126394-48126416 AAACTTGAGAAGCTTGTGTCAGG + Intergenic
1124249023 15:28095418-28095440 AATCTTAAGAACATTGTGGCCGG + Intronic
1126016717 15:44358858-44358880 AAGATTTAGAAACTTCTGGCCGG + Intronic
1126028763 15:44475340-44475362 AACTTTAAGATTCTTCAGGCCGG + Intronic
1126224805 15:46258610-46258632 CTCCTTAAGAAGCTTTTGGGAGG + Intergenic
1127333722 15:57963637-57963659 TACTTTAAGAATATTCTGGCCGG - Intronic
1127839539 15:62819154-62819176 AACTGTAAGAACATTCTGGCTGG - Intronic
1129356889 15:74997269-74997291 AACCTTCCGAAACTCCTGGCTGG - Exonic
1130108479 15:80946454-80946476 AACCTTCAGGAGCTCCTGGATGG + Intronic
1130779528 15:87020608-87020630 TAGCTTAAGAAGCTTTTGGGTGG - Intronic
1130927602 15:88397063-88397085 AGCCTCAAGAAGCTACAGGCTGG - Intergenic
1140061309 16:71572185-71572207 CATCTTCAGAAGATTCTGGCAGG - Exonic
1141920404 16:87132044-87132066 ACCCTTAATAACCTTCTGGATGG - Intronic
1142842975 17:2648378-2648400 AACATTAAGAAATTTATGGCCGG + Intronic
1142906549 17:3046724-3046746 TTCCTTAAGAAGCTACTGGGGGG - Intergenic
1143226283 17:5307016-5307038 AACTTTGAGAAGCTTATGGAAGG + Intronic
1144445061 17:15319558-15319580 AACCAAAAGAAGCTTCTCTCTGG + Intronic
1145023427 17:19449845-19449867 AGCCTTAGGAAGCTTCTGTTGGG + Intergenic
1146819467 17:35973290-35973312 AACCATCAGAAGTTTCTGGCAGG + Intergenic
1147218754 17:38915833-38915855 ACCCTTACCAAGCTCCTGGCAGG + Intronic
1157188573 18:45561159-45561181 AACCATAAGACTCTTCTGCCTGG - Intronic
1158607544 18:58909251-58909273 AACATTAAAAATCTTCAGGCAGG - Intronic
1159224607 18:65516481-65516503 AATCTTAAGAAGCTCATAGCTGG - Intergenic
1164072848 19:21785029-21785051 AACCATAAGAAACCTCTGGTAGG - Intergenic
1165117037 19:33534789-33534811 AATCTTTAAAAGCTTCTAGCAGG + Intergenic
1165290053 19:34876056-34876078 AACTTTAAGAAAGTTTTGGCTGG + Intergenic
1166881662 19:45933947-45933969 CACCTCCAGAAGCTCCTGGCTGG - Exonic
1167000312 19:46741875-46741897 AAGCTTCAGCAGCTGCTGGCAGG + Intronic
925221499 2:2145136-2145158 CGCCTTAGGAAGCTCCTGGCAGG + Intronic
927041186 2:19232062-19232084 ACCTTTAAGGAGCTTCTGGCTGG - Intergenic
928130028 2:28642637-28642659 AACCAAAAGAAGGTTCTAGCTGG + Intronic
930034555 2:47077253-47077275 AATTCTAAGAAGTTTCTGGCAGG - Intronic
932968593 2:76509817-76509839 AACATCAAGCAGCTTCTGACTGG + Intergenic
933144177 2:78830852-78830874 AACCTTAAGAAACTCATGGCCGG - Intergenic
939677864 2:145094917-145094939 AATCTAAAGAATCTTCTGGTGGG + Intergenic
940395394 2:153184352-153184374 CAACTTAAGAAGCTTTTGGGTGG + Intergenic
940741399 2:157513247-157513269 AACTTTAAAAATCTTGTGGCCGG - Intergenic
942127582 2:172842698-172842720 AAATTGAAGAAGCTTCTGCCTGG - Intronic
942461793 2:176173302-176173324 AAACCTAAGAAGGTTCTGGGCGG + Intergenic
942608903 2:177720860-177720882 TGCCTTCAGAAGCTTCTGGTTGG - Intronic
945738370 2:213630085-213630107 AACTTAAAGATGTTTCTGGCTGG + Intronic
945804218 2:214470479-214470501 AACCTTAAGAATCATTTGGTTGG - Intronic
1170033222 20:11964011-11964033 AATTTTAGGAGGCTTCTGGCTGG + Intergenic
1170302754 20:14904031-14904053 AACACTAAGAAGTTTCTGCCTGG + Intronic
1172707930 20:36896538-36896560 AACAGTAAGAACTTTCTGGCTGG + Intronic
1176865692 21:14053436-14053458 CTCCTTAAGAAGCTTTTGGGAGG + Intergenic
1178633130 21:34279948-34279970 AGCCTTAAGATGTTTCTGCCTGG + Intergenic
1178870429 21:36369924-36369946 AACCTTAAGAAGCTGCCAGTTGG + Intronic
1181963942 22:26643336-26643358 GACCTTTAGCAGCTTCTGGGTGG + Intergenic
1182011676 22:27006417-27006439 AATCTTAAGAAACGTCTGGTTGG + Intergenic
1185269786 22:49924032-49924054 ATTCTTAGGAAGCTCCTGGCAGG + Intronic
950551437 3:13668621-13668643 GTCTTTAGGAAGCTTCTGGCTGG + Intergenic
950690024 3:14648246-14648268 AAGGTTAAGATGCTTCGGGCTGG + Intergenic
952438689 3:33300083-33300105 AATCATAAGCAGCTTCAGGCAGG + Intronic
954671980 3:52296113-52296135 AACCTCATGAAGATTTTGGCAGG + Intergenic
954981717 3:54751903-54751925 AACCTTAAGTACCATCTGGCAGG + Intronic
956355423 3:68386790-68386812 AAACAAAATAAGCTTCTGGCAGG - Intronic
957144437 3:76405209-76405231 AACCTTAAGAAGCTTCTGGCTGG - Intronic
961777819 3:129302416-129302438 ATAATTAAGAAGCTTCAGGCTGG + Intronic
962441429 3:135421721-135421743 AAAATTGACAAGCTTCTGGCAGG + Intergenic
962640450 3:137380026-137380048 TAGCTTAAGAAGCTTTTGGGTGG - Intergenic
964487142 3:157197772-157197794 ATCCTTCAGTAGCTTCTTGCAGG + Intergenic
965964164 3:174466763-174466785 AACCTTAACAAACTTCGGGTTGG + Intronic
969347895 4:6580671-6580693 AACCTCAAGATGCCCCTGGCAGG + Intronic
970495337 4:16619244-16619266 AGCCTTGAGGAGTTTCTGGCAGG - Intronic
972532428 4:39973779-39973801 AACCTGAAGGAGGTGCTGGCTGG - Intronic
975454718 4:74576527-74576549 AACCTTAAAAATCTTCTGGTGGG - Intergenic
976121699 4:81790592-81790614 AACCCTAAGAAACGCCTGGCTGG - Intronic
977554098 4:98471255-98471277 AACCATTAGAAGCTTTTGACTGG + Exonic
977752428 4:100625410-100625432 CAGCTTAAGAAGCTTTTGGGTGG - Intronic
981407444 4:144387435-144387457 AACCTTAAGAACATTCTGACTGG + Intergenic
981628455 4:146788822-146788844 AAACTTAAGAAACTTTTGGAAGG + Intronic
985178633 4:187231157-187231179 AACCTGAAGAAGAATCTTGCAGG + Intergenic
986072185 5:4296258-4296280 ACTGTTGAGAAGCTTCTGGCAGG + Intergenic
988933258 5:36057834-36057856 AACTTTGAGAAACTACTGGCTGG - Intronic
991625767 5:68599499-68599521 AAGCTTCTGAAGTTTCTGGCAGG + Intergenic
993822717 5:92639668-92639690 AACACTAAGCAGCTTGTGGCAGG - Intergenic
994515890 5:100772618-100772640 AACCTAAAGCAGATTCTGGCTGG + Intergenic
997954976 5:138272300-138272322 AACTTTAAGAAAATACTGGCTGG - Intronic
1000415122 5:160976316-160976338 AGCCTTAAGGAGATTCTGGAAGG - Intergenic
1003061187 6:2863978-2864000 AGCCTTAAGAAGCCTCAGCCTGG - Intergenic
1008199752 6:48571763-48571785 ACACATCAGAAGCTTCTGGCAGG - Intergenic
1008570662 6:52813521-52813543 AACCTTGAATGGCTTCTGGCTGG + Intergenic
1020437906 7:8185603-8185625 AATCTTAAGAACCATCTGCCTGG + Intronic
1026687213 7:72521630-72521652 AACCATTAGAATCTTCTGGATGG + Intergenic
1026779241 7:73253198-73253220 ATCATTAACAATCTTCTGGCCGG - Intergenic
1027020100 7:74806604-74806626 ATCATTAACAATCTTCTGGCCGG - Intronic
1027067926 7:75139335-75139357 ATCATTAACAATCTTCTGGCCGG + Intronic
1030536277 7:110771090-110771112 AACCTTTGGAAGGTTCTGACGGG + Intronic
1032244995 7:130203924-130203946 AACTTTAAGAAGCCAGTGGCTGG - Intronic
1037946222 8:22991211-22991233 CACCTCAGGAAACTTCTGGCCGG + Intronic
1039271825 8:35890455-35890477 AACCTTAAGAAATCTTTGGCAGG + Intergenic
1039574183 8:38610648-38610670 AATCTGAAGCAGCTTCTGGGGGG + Intergenic
1039832117 8:41223702-41223724 CACCTTAAGAAGCTTCTAGGCGG - Intergenic
1040946575 8:52891468-52891490 AACCTTGACAAGCACCTGGCAGG - Intergenic
1043259080 8:78175304-78175326 AATCTTAATAATCTTCTGCCTGG - Intergenic
1043464645 8:80492770-80492792 TCCCTTAAGAATCTTCAGGCCGG - Intronic
1043502032 8:80867723-80867745 GACTTTAAGAAGCCTTTGGCAGG - Intronic
1044013001 8:87017945-87017967 AACTTTAAAAAAATTCTGGCCGG + Intronic
1045276365 8:100709482-100709504 AACCTGAAGGAGGTGCTGGCTGG + Exonic
1045317867 8:101058907-101058929 GAACTCAGGAAGCTTCTGGCTGG - Intergenic
1046684663 8:117211567-117211589 CAGCTTAAGAAGCTTTTGGTTGG - Intergenic
1047887329 8:129266137-129266159 ATCCTGAAGAAGCTGATGGCTGG + Intergenic
1051909100 9:22132584-22132606 AACCTTGGGAAGCTCCTGGGAGG - Intergenic
1055511473 9:76999626-76999648 ATACTTAAGAAGCTCCTGGTTGG - Intergenic
1055702361 9:78959214-78959236 AACCTTAAGAAATTACTGCCAGG - Intergenic
1058514831 9:105760300-105760322 GATCTTGATAAGCTTCTGGCTGG + Intronic
1059288343 9:113197737-113197759 AACCTTATGAAGTTTTTGGAGGG - Intronic
1059334597 9:113560925-113560947 AAAGCTAAGCAGCTTCTGGCAGG + Intronic
1060610438 9:124959395-124959417 AACCTTCAAAAGCTACTGGTGGG + Intronic
1062615687 9:137394767-137394789 AACCTGAAAAAGCTGCTGGGAGG + Intronic
1186406239 X:9306088-9306110 ATCTTTGAGAAGCTTCTGGAAGG - Intergenic
1188874806 X:35416697-35416719 AAGCATAAGAAGACTCTGGCCGG - Intergenic
1189207306 X:39253014-39253036 AACCACCAGAAGCTTCTGGAGGG - Intergenic
1189299526 X:39942428-39942450 AACCTTTAGAGTCTTCAGGCAGG - Intergenic
1193077819 X:77374261-77374283 AACCTTCAGAAGGATGTGGCTGG - Intergenic
1200396924 X:155996481-155996503 CAGCTTAAGAAGTGTCTGGCTGG + Intergenic