ID: 957146775

View in Genome Browser
Species Human (GRCh38)
Location 3:76434769-76434791
Sequence CTGTTTGCGCAGATTAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 2, 1: 1, 2: 1, 3: 3, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
957146766_957146775 27 Left 957146766 3:76434719-76434741 CCCCAGTCTCTACCAGTTGAGGC 0: 1
1: 0
2: 0
3: 15
4: 114
Right 957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG 0: 2
1: 1
2: 1
3: 3
4: 64
957146764_957146775 28 Left 957146764 3:76434718-76434740 CCCCCAGTCTCTACCAGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 114
Right 957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG 0: 2
1: 1
2: 1
3: 3
4: 64
957146770_957146775 -6 Left 957146770 3:76434752-76434774 CCGCTTCCTGCTCAGCCCTGTTT 0: 1
1: 0
2: 4
3: 51
4: 483
Right 957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG 0: 2
1: 1
2: 1
3: 3
4: 64
957146768_957146775 25 Left 957146768 3:76434721-76434743 CCAGTCTCTACCAGTTGAGGCTC 0: 1
1: 0
2: 1
3: 9
4: 106
Right 957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG 0: 2
1: 1
2: 1
3: 3
4: 64
957146767_957146775 26 Left 957146767 3:76434720-76434742 CCCAGTCTCTACCAGTTGAGGCT 0: 1
1: 0
2: 0
3: 12
4: 92
Right 957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG 0: 2
1: 1
2: 1
3: 3
4: 64
957146769_957146775 15 Left 957146769 3:76434731-76434753 CCAGTTGAGGCTCAGATGAGTCC 0: 1
1: 0
2: 6
3: 32
4: 142
Right 957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG 0: 2
1: 1
2: 1
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957146775 Original CRISPR CTGTTTGCGCAGATTAATCA GGG Intronic
904303183 1:29569298-29569320 CTGTTTTCTCAGCTTCATCAGGG + Intergenic
905706957 1:40067678-40067700 CTGTTCGCGCAGATTAATCAGGG + Exonic
906307888 1:44732236-44732258 CTGTTTGTTCAGATTATTCTTGG - Intergenic
907539240 1:55197201-55197223 CTTTTTGAGTAGATTATTCAAGG - Intronic
908443361 1:64177692-64177714 CTTTTTGAGTATATTAATCAGGG + Exonic
913520453 1:119640590-119640612 CTGTTTGCACAGCTGAATCAAGG - Intronic
919643215 1:200065817-200065839 CTGTGTGTCCAGATTTATCAAGG - Intronic
1065398713 10:25271161-25271183 CTATTTGAGCAGATTACTGAAGG - Intronic
1066287702 10:33984400-33984422 CTGTTTTCACTTATTAATCATGG + Intergenic
1067135655 10:43605463-43605485 CTGTTTGCGCAGATTAATCAGGG - Intergenic
1069215585 10:65814952-65814974 CTAACTGCACAGATTAATCATGG + Intergenic
1071139831 10:82495549-82495571 CTGTTTTCCCAGAGTAATCTGGG + Intronic
1085429190 11:76432317-76432339 CTGTTTGCTCAGATTCTTCTTGG + Intergenic
1086531154 11:87786754-87786776 CTGTTTGTGCAGATTCTTCTTGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1106160975 13:27201223-27201245 CTGTTTGTTCAGATTCTTCAAGG + Intergenic
1108133132 13:47325171-47325193 CTGTTTGCCCAGAATGCTCAGGG - Intergenic
1114570995 14:23668475-23668497 TTGGTTGCACAGATTAATCATGG + Intergenic
1116125482 14:40779073-40779095 ATGTATGGGCACATTAATCAAGG - Intergenic
1117243936 14:53864607-53864629 CTGTTTGCCCAGAATAATTTTGG + Intergenic
1118757630 14:68856346-68856368 CTGTTTGCTCAGATTCTTCTTGG - Intergenic
1125403032 15:39324643-39324665 CTGTTTGAGCATATTCATAAGGG - Intergenic
1133519055 16:6539293-6539315 CTGTTTTCCCAAATAAATCATGG + Intronic
1135241735 16:20813171-20813193 CTTTCTGCAAAGATTAATCAGGG - Exonic
1138345699 16:56318875-56318897 CTGTTTGTGCAGATAAAACGGGG - Intronic
1141851454 16:86649123-86649145 CTGTTGGCCCAGATTAAGCCTGG + Intergenic
1146811019 17:35903297-35903319 CTGTTTGCTCAGATTCTTCTTGG - Intergenic
1151046976 17:70932049-70932071 ATGTTTTGGCACATTAATCAAGG + Intergenic
1159879352 18:73843970-73843992 GTTTTTGCACAGATGAATCACGG + Intergenic
926730930 2:16034846-16034868 CTGTTTGGACACATTGATCAAGG + Intergenic
931755597 2:65371362-65371384 CTGTTTGAACAGATTAAACTGGG + Intronic
936240411 2:110783448-110783470 CTGTTTGTTCAAATTAATAATGG + Intronic
936601406 2:113899556-113899578 TTGTTTGGGCAGATTAATAAGGG + Intronic
939709097 2:145493047-145493069 CTCATTGAGCAGAGTAATCATGG - Intergenic
944648285 2:201802493-201802515 CTGTTTGTTCAGATTATTCTTGG - Intronic
945207859 2:207351352-207351374 CTGTTTGCTCAGATTCTTCTTGG + Intergenic
947092885 2:226532627-226532649 GTGTCTGAGCAGGTTAATCAAGG - Intergenic
947486963 2:230559375-230559397 TTGTTTGTACAGATTCATCATGG - Intergenic
1177035745 21:16040393-16040415 CTGTTTGAGCAGACTAGGCATGG + Intergenic
1181298734 22:21863763-21863785 CTGTTAGAGCAGATTTGTCAGGG - Intronic
1182440528 22:30361322-30361344 CTGTTTGCTCAGATTCTTCTTGG + Intronic
949748133 3:7319121-7319143 CTGATTCCCCAAATTAATCATGG - Intronic
952704646 3:36365121-36365143 ATGTTGACGTAGATTAATCAAGG + Intergenic
957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG + Intronic
960223035 3:115138496-115138518 GTGCTTGCCCAGATTAATAATGG - Intronic
960553280 3:119000756-119000778 CTGTTTGCCCAGAATAATTTTGG - Intronic
964316617 3:155451658-155451680 CTGTTGGTGCAAAGTAATCATGG + Intronic
967102570 3:186228458-186228480 CTTTTTGAACAGATTAATGAAGG - Intronic
970431618 4:15994165-15994187 CTGTGTTCACAGATTAAACAAGG - Intronic
981772338 4:148324109-148324131 CTGTTTTCTCTGGTTAATCATGG - Intronic
989301288 5:39896820-39896842 CTGTTTGAGCATATAAAACAAGG - Intergenic
989466254 5:41758934-41758956 CTGTGTGCCCAGATAAAACAGGG + Intronic
989487354 5:42007562-42007584 CTGGGTACTCAGATTAATCAAGG - Intergenic
992258296 5:74944355-74944377 CTGTTTGTGCAGATTCTTCCTGG + Intergenic
1000228839 5:159296271-159296293 ATGTGTGCGCAGAACAATCAGGG - Intergenic
1002039402 5:176501329-176501351 CTGATCGCTCAGAATAATCAAGG + Intronic
1020447941 7:8289107-8289129 CTGTTAGCTCAAATTAATAAGGG + Intergenic
1026847390 7:73705682-73705704 GTGTTTGCGCATATGACTCAGGG - Intronic
1041188936 8:55333380-55333402 CAGTTTGAGCTGATTAATGAAGG - Intronic
1045911870 8:107419398-107419420 CTGTTTATGCAGATTCATCCTGG - Intronic
1050542701 9:6683632-6683654 CTGTTTGTTCAGATTATTCTTGG - Intergenic
1052711896 9:32067415-32067437 CTCTTTGAGAAGATTAAGCATGG + Intergenic
1052894202 9:33731969-33731991 CTGTTTGTGCAGATGAATTCAGG + Intergenic
1054769163 9:69068313-69068335 CTGTTTGCACAGCAAAATCAGGG + Intronic
1057024792 9:91726541-91726563 CTGTTTGTGCTGGTTAATGAGGG + Exonic
1057139456 9:92717859-92717881 CTCATTGCGCAGCTTCATCATGG + Exonic
1058524242 9:105840932-105840954 CTGTTTCTGCAGGTAAATCATGG + Intergenic
1188385195 X:29548898-29548920 CTGTTTGCCTTGATTCATCAAGG + Intronic
1193104016 X:77648659-77648681 CTTTTTGCACAGATTAATCAAGG + Intronic
1196177020 X:112649877-112649899 CTCATTGTGCAGAGTAATCAGGG + Intronic
1196747545 X:119085264-119085286 CTCTTTGGGAACATTAATCAAGG - Intronic