ID: 957148257

View in Genome Browser
Species Human (GRCh38)
Location 3:76452318-76452340
Sequence TTGTGTGGGGGGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20548
Summary {0: 1, 1: 14, 2: 470, 3: 8723, 4: 11340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
957148257 Original CRISPR TTGTGTGGGGGGAAGGGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr